-
Biology Jul 2022The use of microbial products as natural biocontrol agents to increase a plant's systemic resistance to viral infections is a promising way to make agriculture more...
The use of microbial products as natural biocontrol agents to increase a plant's systemic resistance to viral infections is a promising way to make agriculture more sustainable and less harmful to the environment. The rhizobacterium has been shown to have strong biocontrol action against plant diseases, but its antiviral activity has been little investigated. Here, the efficiency of the culture filtrate of the strain SZYM (Acc# ON149452) to protect squash ( L.) plants against a (ZYMV, Acc# ON159933) infection was evaluated. Under greenhouse conditions, the foliar application of the culture filtrate of SZYM either in protective or curative treatment conditions enhanced squash growth, reduced disease severity, and decreased ZYMV accumulation levels in the treated plants when compared to the non-treated plants. The protective treatment group exhibited the highest inhibitory effect (80%), with significant increases in their total soluble carbohydrates, total soluble protein content, ascorbic acid content, and free radical scavenging activity. Furthermore, a considerable increase in the activities of reactive oxygen species scavenging enzymes (superoxide dismutase, polyphenol oxidase, and peroxidase) were also found. In addition, the induction of systemic resistance with a significant elevation in the transcriptional levels of polyphenolic pathway genes (, , and ) and pathogenesis-related genes ( and ) was observed. Out of the 14 detected compounds in the GC-MS analysis, propanoic acid, benzenedicarboxylic acid, tetradecanoic acid, and their derivatives, as well as pyrrolo [1,2-a] pyrazine-1,4-dione, hexahydro-3-(2-methylpropyl) were the primary ingredient compounds in the ethyl acetate extract of the SZYM-culture filtrate. Such compounds may act as elicitor molecules that induce systemic resistance against viral infection. Consequently, can be considered a powerful plant growth-promoting bacterium (PGPB) in agricultural applications as well as a source of bioactive compounds for sustainable disease management. As far as we know, this is the first time that has been shown to fight viruses in plants.
PubMed: 36009777
DOI: 10.3390/biology11081150 -
International Journal of Molecular... Apr 2022With numerous industrial applications, has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression...
With numerous industrial applications, has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was "ACTTAGTTTAAGCAATAGACAAAGT", and this can be degenerated to "ACTTWGTTTAWSSNATAVACAAAGT" in spp., which differs from that in the spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter P. The eGFP fluorescence intensity assay indicated that both the modified and original P had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in spp. that can dynamically regulate its gene circuit strength through xylose.
Topics: Gene Expression; Operon; Paenibacillus; Paenibacillus polymyxa; Xylose
PubMed: 35563415
DOI: 10.3390/ijms23095024 -
Genomics Jan 2021The legislations on the usage of antibiotics as growth promoters and prophylactic agents have compelled to develop alternative tools to upsurge the animal protection and...
The legislations on the usage of antibiotics as growth promoters and prophylactic agents have compelled to develop alternative tools to upsurge the animal protection and contain antibiotic usage. Probiotics have emerged as an effective antibiotic substitute in animal farming. The present study explores the probiotic perspective of Paenibacillus polymyxa HK4 interlinking the genotypic and phenotypic characteristics. The draft genome of HK4 revealed the presence of ORFs encoding the functions associated with tolerance to gastrointestinal stress and adhesion. The biosynthetic gene clusters encoding non-ribosomally synthesized peptides, polyketides and lanthipeptides such as fusaricidin, tridecaptin, polymyxin, paenilan and paenibacillin were annotated in HK4 genome. The strain harbored the chromosomal gene conferring the resistance to lincosamides. No functional gene encoding virulence or toxins could be identified in the genome of HK4. The genome analysis data was complemented by the in vitro experiments confirming its survival during gastrointestinal transit, antimicrobial potential and antibiotic sensitivity. NUCLEOTIDE SEQUENCE ACCESSION NUMBER: The draft-genome sequence of Paenibacillus polymyxa HK4 has been deposited as whole-genome shotgun project at GenBank under the accession number PRJNA603023.
Topics: Anti-Bacterial Agents; Genome, Bacterial; Paenibacillus polymyxa; Polyketides; Polymyxins; Probiotics
PubMed: 33096257
DOI: 10.1016/j.ygeno.2020.10.017 -
Journal of Applied Microbiology Apr 2024In this work, we aimed to isolate marine bacteria that produce metabolites with antifungal properties.
AIMS
In this work, we aimed to isolate marine bacteria that produce metabolites with antifungal properties.
METHODS AND RESULTS
Paenibacillus polymyxa 188 was isolated from a marine sediment sample, and it showed excellent antifungal activity against many fungi pathogenic to plants (Fusarium tricinctum, Pestalotiopsis clavispora, Fusarium oxysporum, F. oxysporum f. sp. Cubense (Foc), Curvularia plantarum, and Talaromyces pinophilus) and to humans (Aspergillus terreus, Penicillium oxalicum, and Microsphaeropsis arundinis). The antifungal compounds produced by P. polymyxa 188 were extracted and analyzed using matrix-assisted laser desorption ionization time-of-flight mass spectrometry. The complete genome sequence and biosynthetic gene clusters of P. polymyxa 188 were characterized and compared with those of other strains. A total of 238 carbohydrate-active enzymes (CAZymes) were identified in P. polymyxa 188. Two antibiotic gene clusters, fusaricidin and tridecaptin, exist in P. polymyxa 188, which is different from other strains that typically have multiple antibiotic gene clusters.
CONCLUSIONS
Paenibacilluspolymyxa 188 was identified with numerous biosynthetic gene clusters, and its antifungal ability against pathogenic fungi was verified.
Topics: Humans; Paenibacillus polymyxa; Antifungal Agents; Anti-Bacterial Agents; Paenibacillus
PubMed: 38509027
DOI: 10.1093/jambio/lxae075 -
Methods in Molecular Biology (Clifton,... 2020The skin contains three primary layers: epidermis, dermis, and hypodermis. Separation of epidermal components from dermis (dermal-epidermal separation) is an important...
The skin contains three primary layers: epidermis, dermis, and hypodermis. Separation of epidermal components from dermis (dermal-epidermal separation) is an important basic investigation technique for pharmacology, toxicology, and biology. There are different systems of epidermal separation, including typical methods of chemical, enzyme, heat, etc. Each approach has advantages versus disadvantages, and thus the appropriate method should be chosen for a given research question. Here we described the method of enzyme separation.
Topics: Bacterial Proteins; Cell Separation; Dermis; Endopeptidases; Epidermal Cells; Humans; Paenibacillus polymyxa; Skin; Trypsin
PubMed: 31792753
DOI: 10.1007/7651_2019_267 -
Frontiers in Microbiology 2022The multiple-sugar metabolism regulator (MsmR), a transcription factor belonging to the AraC/XylS family, participates in polysaccharide metabolism and virulence....
The multiple-sugar metabolism regulator (MsmR), a transcription factor belonging to the AraC/XylS family, participates in polysaccharide metabolism and virulence. However, the transcriptional regulatory mechanisms of MsmR1 in remain unclear. In this study, knocking out was found to reduce polymyxin synthesis by the SC2-M1 strain. Chromatin immunoprecipitation assay with sequencing (ChIP-seq) revealed that most enriched pathway was that of carbohydrate metabolism. Additionally, electromobility shift assays (EMSA) confirmed the direct interaction between MsmR1 and the promoter regions of , , , , , , , and . MsmR1 stimulates polymyxin biosynthesis by directly binding to the promoter regions of and , while also directly regulating and influencing the citrate cycle (TCA cycle). In addition, MsmR1 directly activates and was beneficial for spore and biofilm formation. These results indicated that MsmR1 could regulate carbohydrate and amino acid metabolism, and indirectly affect biological processes such as polymyxin synthesis, biofilm formation, and motility. Moreover, MsmR1 could be autoregulated. Hence, this study expand the current knowledge of MsmR1 and will be beneficial for the application of SC2 in the biological control against the certain pathogens in pepper.
PubMed: 36483206
DOI: 10.3389/fmicb.2022.1039806 -
ACS Synthetic Biology Jan 2022The use of molecular tools based on the clustered regularly interspaced short palindromic repeats-Cas (CRISPR-Cas) systems has rapidly advanced genetic engineering....
The use of molecular tools based on the clustered regularly interspaced short palindromic repeats-Cas (CRISPR-Cas) systems has rapidly advanced genetic engineering. These molecular biological tools have been applied for different genetic engineering purposes in multiple organisms, including the quite rarely explored . However, only limited studies on large cluster deletion and multiplex genome editing have been described for this highly interesting and versatile bacterium. Here, we demonstrate the utilization of a Cas9-based system to realize targeted deletions of four biosynthetic gene clusters in the range of 12-41 kb by the use of a single targeting sgRNA. Furthermore, we also harnessed the system for multiplex editing of genes and large genomic regions. Multiplex deletion was achieved with more than 80% efficiency, while simultaneous integration at two distantly located sites was obtained with 58% efficiency. The findings reported in this study are anticipated to accelerate future research in and related species.
Topics: CRISPR-Cas Systems; Gene Editing; Genetic Engineering; Paenibacillus polymyxa
PubMed: 34914351
DOI: 10.1021/acssynbio.1c00565 -
International Journal of Molecular... Feb 2024Screening of with antagonistic effects on paddy mold pathogens to provide strain resources for biological control of mold in L. screening of isolates antagonistic...
Screening of with antagonistic effects on paddy mold pathogens to provide strain resources for biological control of mold in L. screening of isolates antagonistic towards from rhizosphere soil of healthy paddy; classification and identification of antagonistic strains by biological characteristics and 16S rDNA sequence analysis; transcriptome sequencing after RNA extraction from Bacillus-treated ; and extraction of inhibitory crude proteins of by ammonium sulfate precipitation; inhibitory crude protein and spp. were treated separately for and observed by scanning electron microscopy (SEM). An antagonistic strain of , named B7, was identified as by 16S rDNA identification and phylogenetic evolutionary tree comparison analysis. Analysis of the transcriptome results showed that genes related to secondary metabolite biosynthesis such as antifungal protein were significantly downregulated. SEM results showed that the mycelium of underwent severe rupture after treatment with and antifungal proteins, respectively. In addition, the sporocarp changed less after treatment with , and the sporangium stalks had obvious folds. B7 has a good antagonistic effect against and has potential for biocontrol applications of paddy mold pathogens.
Topics: Paenibacillus polymyxa; Antifungal Agents; Phylogeny; Antibiosis; Bacillus; DNA, Ribosomal; Paenibacillus; Aspergillus
PubMed: 38396880
DOI: 10.3390/ijms25042195 -
Enzyme and Microbial Technology Mar 2023Recently, there has been increased interest in the synthesis of nanoparticles by using natural polysaccharides. These polysaccharides are eco-friendly, nontoxic, and...
Recently, there has been increased interest in the synthesis of nanoparticles by using natural polysaccharides. These polysaccharides are eco-friendly, nontoxic, and cheap to prepare. On the other hand, the attention in hydrocolloids and films has significantly enhanced, and their application is very promising in the food, pharmaceutical, perfumery and cosmetics, oil, paper, and textile industries. In this context, the present study is aimed to prepare silver nanoparticles by using viscous and superviscous exopolysaccharides of the rhizobacterium Paenibacillus polymyxa strains, CCM 1465 and 88A, and examined the properties of the resultant nanoparticles. We examined the synthesis and properties of silver nanoparticles under variable synthetic conditions by using exopolysaccharides of the rhizobacteria Paenibacillus polymyxa CCM 1465 and 88A. To prepare nanoparticles, we used different combinations of exopolysaccharide and silver nitrate concentrations: 1-10 mg/mL and 1-40 mM, respectively. The resulting solutions were alkalinized from pH 7.5-12 and heated for 15, 30, and 60 min to determine the optimal synthetic conditions. We found that the exopolysaccharides of strains CCM 1465 and 88A reduced silver ions and acted as nanoparticle stabilizers. The prepared spherical, oval, and triangular particles were stable and ranged in size from 2 to 40 nm, depending on the strain and on the experimental conditions. The nanoparticles showed antibacterial and antifungal activity against Escherichia coli K-12, Pseudomonas aeruginosa 50.3, Bacillus subtilis 26-D, and Fusarium oxysporum. In addition, the nanoparticles were active against SK-MEL-2 human melanoma cells. This finding shows the promise of further research on the exopolysaccharides of P. polymyxa 1465 and 88А in different fields of science, including medicine.
Topics: Humans; Paenibacillus polymyxa; Metal Nanoparticles; Escherichia coli K12; Silver; Polysaccharides; Anti-Bacterial Agents; Escherichia coli
PubMed: 36508942
DOI: 10.1016/j.enzmictec.2022.110174 -
Frontiers in Microbiology 2022Brewers' spent grains (BSG) are a by-product of the brewing industry that is mainly used as feedstock; otherwise, it has to be disposed according to regulations. Due to...
Brewers' spent grains (BSG) are a by-product of the brewing industry that is mainly used as feedstock; otherwise, it has to be disposed according to regulations. Due to the high content of glucose and xylose, after pretreatment and hydrolysis, it can be used as a main carbohydrate source for cultivation of microorganisms for production of biofuels or biochemicals like 2,3-butanediol or lactate. 2,3-Butanediol has applications in the pharmaceutical or chemical industry as a precursor for varnishes and paints or in the food industry as an aroma compound. So far, , , , and are being used and investigated in different bioprocesses aimed at the production of 2,3-butanediol. The main drawback is bacterial pathogenicity which complicates all production steps in laboratory, pilot, and industrial scales. In our study, a gram-positive GRAS bacterium DSM 742 was used for the production of 2,3-butanediol. Since this strain is very poorly described in literature, bacterium cultivation was performed in media with different glucose and/or xylose concentration ranges. The highest 2,3-butanediol concentration of 18.61 g l was achieved in medium with 70 g l of glucose during 40 h of fermentation. In contrast, during bacterium cultivation in xylose containing medium there was no significant 2,3-butanediol production. In the next stage, BSG hydrolysates were used for bacterial cultivation. DSM 742 cultivated in the liquid phase of pretreated BSG produced very low 2,3-butanediol and ethanol concentrations. Therefore, this BSG hydrolysate has to be detoxified in order to remove bacterial growth inhibitors. After detoxification, bacterium cultivation resulted in 30 g l of lactate, while production of 2,3-butanediol was negligible. The solid phase of pretreated BSG was also used for bacterium cultivation after its hydrolysis by commercial enzymes. In these cultivations, DSM 742 produced 9.8 g l of 2,3-butanediol and 3.93 g l of ethanol. On the basis of the obtained results, it can be concluded that different experimental setups give the possibility of directing the metabolism of DSM 742 toward the production of either 2,3-butanediol and ethanol or lactate.
PubMed: 35308344
DOI: 10.3389/fmicb.2022.812457