-
Cancer Communications (London, England) Sep 2020Highly active lipogenesis is essential for rapid tumor growth. Sterol regulatory element-binding protein (SREBP) is a key transcriptional factor for lipogenesis and...
Highly active lipogenesis is essential for rapid tumor growth. Sterol regulatory element-binding protein (SREBP) is a key transcriptional factor for lipogenesis and activated by reduced sterol and oxysterol levels. However, the mechanism by which cancer cells activate SREBP without altering these sterol/oxysterol levels remains elusive. In one of our recent studies published in Nature entitled "The gluconeogenic enzyme PCK1 phosphorylates INSIG1/2 for lipogenesis", we demonstrated that activated AKT-mediated phosphoenolpyruvate carboxykinase 1 (PCK1) S90 phosphorylation reduces the gluconeogenic activity of PCK1 and triggers its translocation to the endoplasmic reticulum (ER), where PCK1 acts as a protein kinase and uses GTP, rather than ATP, as a phosphate donor to phosphorylate Insig1/2 thereby reducing oxysterol's binding to Insig1/2 and activating SREBP-mediated lipogenesis for tumor growth. These findings elucidate a coordinated regulation between gluconeogenesis and lipogenesis and uncover a critical role of the protein kinase activity of PCK1 in SREBP-dependent lipid synthesis.
Topics: Humans; Intracellular Signaling Peptides and Proteins; Lipogenesis; Neoplasms; Phosphoenolpyruvate Carboxykinase (GTP); Phosphorylation; Protein Kinases; Sterol Regulatory Element Binding Protein 1
PubMed: 32809272
DOI: 10.1002/cac2.12084 -
Biochimica Et Biophysica Acta.... Jun 2018Human α-adrenoceptors (α-ARs) are a group of the seven transmembrane-spanning proteins that mediate many of the physiological and pathophysiological actions of...
Human α-adrenoceptors (α-ARs) are a group of the seven transmembrane-spanning proteins that mediate many of the physiological and pathophysiological actions of adrenaline and noradrenaline. Although it is known that α-ARs are phosphoproteins, their specific phosphorylation sites and the kinases involved in their phosphorylation remain largely unknown. Using a combination of in silico analysis, mass spectrometry and site directed mutagenesis, we identified distinct α-AR phosphorylation patterns during noradrenaline- or phorbol ester-mediated desensitizations. We found that the G protein coupled receptor kinase, GRK2, and conventional protein kinases C isoforms α/β, phosphorylate α-AR during these processes. Furthermore, we showed that the phosphorylated residues are located in the receptor's third intracellular loop (S300, S323, T328, S331, S332, S334) and carboxyl region (S441, T442, T477, S486, S492, T507, S515, S516, S518, S543) and are conserved among orthologues but are not conserved among the other human α-adrenoceptor subtypes. Additionally, we found that phosphorylation in either the third intracellular loop or carboxyl tail was sufficient to regulate calcium signaling desensitization. By contrast, mutations in either of these two domains significantly altered mitogen activated protein kinase (ERK) pathway and receptor internalization, suggesting that they have differential regulatory mechanisms. Our data provide new insights into the functional repercussions of these posttranslational modifications in signaling outcomes and desensitization.
Topics: HEK293 Cells; Humans; MAP Kinase Signaling System; Phosphorylation; Protein Domains; Protein Structure, Secondary; Receptors, Adrenergic, alpha-1
PubMed: 29551601
DOI: 10.1016/j.bbamcr.2018.03.006 -
Journal of Molecular Biology Jan 2019In spite of the availability of a significant amount of structural detail on docking interactions involving mitogen-activated protein kinases (MAPKs) and their... (Review)
Review
In spite of the availability of a significant amount of structural detail on docking interactions involving mitogen-activated protein kinases (MAPKs) and their substrates, the mechanism by which the disordered phospho-acceptor on the substrate transiently interacts with the kinase catalytic elements and is phosphorylated, often with high efficiency, remains poorly understood. Here, this dynamic interaction is analyzed in the context of available biophysical and biochemical data for ERK2, an archetypal MAPK. A hypothesis about the nature of the ternary complex involving a MAPK, its substrate, and ATP immediately prior to the chemical step (the pre-chemistry complex) is proposed. It is postulated that the solution ensemble (the pre-chemistry ensemble) representing the pre-chemistry complex comprises several conformations that are linked by dynamics on multiple timescales. These individual conformations possess different intrinsic abilities to proceed through the chemical step. The overall rate of chemistry is therefore related to the microscopic nature of the pre-chemistry ensemble, its constituent conformational microstates, and their intrinsic abilities to yield a phosphorylated product. While characterizing these microstates within the pre-chemistry ensemble in atomic or near-atomic detail is an extremely challenging proposition, recent developments in hybrid methodologies that employ computational approaches driven by experimental data appear to provide the most promising path forward toward achieving this goal.
Topics: Adenosine Triphosphate; Humans; MAP Kinase Signaling System; Mitogen-Activated Protein Kinases; Phosphorylation; Protein Conformation
PubMed: 30562484
DOI: 10.1016/j.jmb.2018.12.007 -
Journal of Cellular Physiology Jan 2021Protein kinase C-δ (PKCδ) is a diacylglycerol-dependent, calcium-independent novel PKC isoform that is engaged in various cell signaling pathways, such as cell...
Protein kinase C-δ (PKCδ) is a diacylglycerol-dependent, calcium-independent novel PKC isoform that is engaged in various cell signaling pathways, such as cell proliferation, apoptosis, inflammation, and oxidative stress. In this study, we searched for proteins that bind PKCδ using a yeast two-hybrid assay and identified murine arrest-defective 1 (mARD1) as a binding partner. The interaction between PKCδ and mARD1 was confirmed by glutathione S-transferase pull-down and co-immunoprecipitation assays. Furthermore, recombinant PKCδ phosphorylated full-length mARD1 protein. The NetPhos online prediction tool suggested PKCδ phosphorylates Ser , Ser , and Ser residues of mARD1 with the highest probability. Based on these results, we synthesized peptides containing these sites and examined their phosphorylations using recombinant PKCδ. Autoradiography confirmed these sites were efficiently phosphorylated. Consequent mass spectrometry and peptide sequencing in combination with MALDI-TOF MS/MS confirmed that Ser and Ser were major phosphorylation sites. The alanine mutations of Ser and Ser abolished the phosphorylation of mARD1 by PKCδ in 293T cells supporting these observations. In addition, kinase assays using various PKC isotypes showed that Ser of ARD1 was phosphorylated by PKCβI and PKCζ isotypes with the highest selectivity, while Ser and/or Ser were phosphorylated by PKCγ with activities comparable to that of the PKCδ isoform. Overall, these results suggest the possibility that PKCδ transduces signals by regulating phosphorylation of ARD1.
Topics: Amino Acid Sequence; Animals; Cell Line; Cell Line, Tumor; HEK293 Cells; HeLa Cells; Humans; Mice; N-Terminal Acetyltransferase A; N-Terminal Acetyltransferase E; Oxidative Stress; Peptides; Phosphorylation; Protein Isoforms; Protein Kinase C-delta; Serine; Signal Transduction
PubMed: 32542692
DOI: 10.1002/jcp.29866 -
Journal of Lipid Research Mar 2024Diacylglycerol kinases (DGKs) are lipid kinases that mediate the phosphorylation of diacylglycerol (DAG) leading to the production of phosphatidic acid (PtdOH). To...
Diacylglycerol kinases (DGKs) are lipid kinases that mediate the phosphorylation of diacylglycerol (DAG) leading to the production of phosphatidic acid (PtdOH). To examine the role of phosphorylation on DGK-θ, we first identified the phosphorylated sites on endogenous DGK-θ from mouse brain and found four sites: S15, S17, which we refer to phosphomotif-1 sites, and S22 and S26 which we refer to as phosphomotif-2 sites. This study focused on the role of these phosphorylated sites on enzyme activity, membrane binding, thermal stability, and cellular half-life of DGK-θ. After generating a construct devoid of all non-catalytic phosphorylation sites (4A), we also generated other constructs to mimic phosphorylation of these residues by mutating them to glutamate (E). Our data demonstrate that an increase in membrane affinity requires the phosphorylation of all four endogenous sites as the phosphomimetic 4E but not other phosphomimietics. Furthermore, 4E also shows an increase in basal activity as well as an increase in the Syt1-induced activity compared to 4A. It is noteworthy that these phosphorylations had no effect on the thermal stability or cellular half-life of this enzyme. Interestingly, when only one phosphorylation domain (phosphomotif-1 or phosphomotif-2) contained phosphomimetics (S15E/S17E or S22E/S26E), the basal activity was also increased but membrane binding affinity was not increased. Furthermore, when only one residue in each domain mimicked an endogenous phosphorylated serine (S15E/S22E or S17E/S26E), the Syt1-induced activity as well as membrane binding affinity decreased relative to 4A. These results indicate that these endogenous phosphorylation sites contribute differentially to membrane binding and enzymatic activity.
Topics: Animals; Mice; Phosphorylation; Diglycerides; Diacylglycerol Kinase
PubMed: 38272356
DOI: 10.1016/j.jlr.2024.100506 -
Advances in Experimental Medicine and... 2022Many pathological conditions are caused by dysregulation of cell signaling, which can generate a cascade of abnormal responses and completely change the functions of a...
Many pathological conditions are caused by dysregulation of cell signaling, which can generate a cascade of abnormal responses and completely change the functions of a cell or tissue. A large portion of the regulation of these signals is via protein phosphorylation, in which cell responses can be activated or inhibited. Proteins that are both downstream and upstream of a phosphorylated protein can be modified, altering metabolism and other biological processes. Recently, the number of phosphoproteomic studies based on mass spectrometry has increased, constantly aiming to obtain a higher coverage of proteins and increase the number and location of their phospho-sites, as well as better understand their respective phosphorylation states. In this way, it is possible to better understand biological processes as a whole and their roles in cellular dysfunctions and diseases. To study changes at the phosphoproteome level, the stochiometric imbalance between the non-phosphorylated and phosphorylated peptides must be overcome, since higher quantities and comparatively better ionization of non-phosphorylated peptides can suppress the ion signals of the phosphorylated peptides. It is for this reason that phosphophopeptides are rarely found in samples that did not pass through a phospho-enrichment step, highlighting the importance of performing enrichment steps in phosphoproteomic studies. The numbers of identified phosphopeptides and phosphorylation sites are extremely important to the quality of a phosphoproteomic analysis; therefore, the efficiency of the enrichment process is critical. Here, phospho-enrichment techniques are presented to offer insight into the applicability of these methods to different experiment types and consequently support the growth of phosphoproteomic studies overall.
Topics: Chromatography, Affinity; Mass Spectrometry; Phosphopeptides; Phosphorylation; Proteome
PubMed: 36029401
DOI: 10.1007/978-3-031-05460-0_2 -
Biochimie Jan 2023An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is...
An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.
Topics: Tumor Suppressor Protein p53; Genes, p53; Phosphorylation; DNA Damage; DNA Repair; DNA
PubMed: 36167255
DOI: 10.1016/j.biochi.2022.09.013 -
Biochemistry and Cell Biology =... Jun 2023The mitogen- and stress-activated protein kinases (MSK) are epigenetic modifiers that regulate gene expression in normal and disease cell states. MSK1 and 2 are involved... (Review)
Review
The mitogen- and stress-activated protein kinases (MSK) are epigenetic modifiers that regulate gene expression in normal and disease cell states. MSK1 and 2 are involved in a chain of signal transduction events bringing signals from the external environment of a cell to specific sites in the genome. MSK1/2 phosphorylate histone H3 at multiple sites, resulting in chromatin remodeling at regulatory elements of target genes and the induction of gene expression. Several transcription factors (RELA of NF-κB and CREB) are also phosphorylated by MSK1/2 and contribute to induction of gene expression. In response to signal transduction pathways, MSK1/2 can stimulate genes involved in cell proliferation, inflammation, innate immunity, neuronal function, and neoplastic transformation. Abrogation of the MSK-involved signaling pathway is among the mechanisms by which pathogenic bacteria subdue the host's innate immunity. Depending on the signal transduction pathways in play and the MSK-targeted genes, MSK may promote or hinder metastasis. Thus, depending on the type of cancer and genes involved, MSK overexpression may be a good or poor prognostic factor. In this review, we focus on mechanisms by which MSK1/2 regulate gene expression, and recent studies on their roles in normal and diseased cells.
Topics: Gene Expression; Histones; Mitogens; Phosphorylation; Protein Kinases; Humans; Animals
PubMed: 36812480
DOI: 10.1139/bcb-2022-0371 -
Biochimica Et Biophysica Acta.... Oct 2021Myosin light chain kinase (MLCK) is a Ca-calmodulin-dependent enzyme dedicated to phosphorylate and activate myosin II to provide force for various motile processes. In...
BACKGROUND
Myosin light chain kinase (MLCK) is a Ca-calmodulin-dependent enzyme dedicated to phosphorylate and activate myosin II to provide force for various motile processes. In smooth muscle cells and many other cells, small MLCK (S-MLCK) is a major isoform. S-MLCK is an actomyosin-binding protein firmly attached to contractile machinery in smooth muscle cells. Still, it can leave this location and contribute to other cellular processes. However, molecular mechanisms for switching the S-MLCK subcellular localization have not been described.
METHODS
Site-directed mutagenesis and in vitro protein phosphorylation were used to study functional roles of discrete in-vivo phosphorylated residues within the S-MLCK actin-binding domain. In vitro co-sedimentation analysis was applied to study the interaction of recombinant S-MLCK actin-binding fragment with filamentous actin. Subcellular distribution of phosphomimicking S-MLCK mutants was studied by fluorescent microscopy and differential cell extraction.
RESULTS
Phosphorylation of S-MLCK actin-binding domain at Ser25 and/or Thr56 by proline-directed protein kinases or phosphomimicking these posttranslational modifications alters S-MLCK binding to actin filaments both in vitro and in cells, and induces S-MLCK subcellular translocation with no effect on the enzyme catalytic properties.
CONCLUSIONS
Phosphorylation of the amino terminal actin-binding domain of S-MLCK renders differential subcellular targeting of the enzyme and may, thereby, contribute to a variety of context-dependent responses of S-MLCK to cellular and tissue stimuli.
GENERAL SIGNIFICANCE
S-MLCK physiological function can potentially be modulated via phosphorylation of its actin recognition domain, a regulation distinct from the catalytic and calmodulin regulatory domains.
Topics: Animals; HEK293 Cells; Humans; Mice; Myosin-Light-Chain Kinase; NIH 3T3 Cells; Phosphorylation; Protein Kinases
PubMed: 34302892
DOI: 10.1016/j.bbamcr.2021.119104 -
The Plant Cell Jul 2021Calcium (Ca2+)/calmodulin (CaM)-dependent protein kinase (CCaMK) is an important positive regulator of abscisic acid (ABA) and abiotic stress signaling in plants and is...
Calcium (Ca2+)/calmodulin (CaM)-dependent protein kinase (CCaMK) is an important positive regulator of abscisic acid (ABA) and abiotic stress signaling in plants and is believed to act upstream of mitogen-activated protein kinase (MAPK) in ABA signaling. However, it is unclear how CCaMK activates MAPK in ABA signaling. Here, we show that OsDMI3, a rice (Oryza sativa) CCaMK, directly interacts with and phosphorylates OsMKK1, a MAPK kinase (MKK) in rice, in vitro and in vivo. OsDMI3 was found to directly phosphorylate Thr-25 in the N-terminus of OsMKK1, and this Thr-25 phosphorylation is OsDMI3-specific in ABA signaling. The activation of OsMKK1 and its downstream kinase OsMPK1 is dependent on Thr-25 phosphorylation of OsMKK1 in ABA signaling. Moreover, ABA treatment induces phosphorylation in the activation loop of OsMKK1, and the two phosphorylations, in the N-terminus and in the activation loop, are independent. Further analyses revealed that OsDMI3-mediated phosphorylation of OsMKK1 positively regulates ABA responses in seed germination, root growth, and tolerance to both water stress and oxidative stress. Our results indicate that OsMKK1 is a direct target of OsDMI3, and OsDMI3-mediated phosphorylation of OsMKK1 plays an important role in activating the MAPK cascade and ABA signaling.
Topics: Abscisic Acid; Calcium; Calcium-Calmodulin-Dependent Protein Kinases; Mitogen-Activated Protein Kinase Kinases; Models, Biological; Oryza; Oxidative Stress; Phosphorylation; Phosphothreonine; Plant Proteins; Protein Binding; Signal Transduction; Stress, Physiological; Water
PubMed: 33630095
DOI: 10.1093/plcell/koab071