-
Virchows Archiv : An International... Jun 2024The objective of this study was to identify clinicopathologic parameters associated with disease outcome in FIGO stage I vulvar squamous cell carcinoma (vSqCC). The...
The objective of this study was to identify clinicopathologic parameters associated with disease outcome in FIGO stage I vulvar squamous cell carcinoma (vSqCC). The cohort consisted of 126 patients diagnosed with vSqCC in the period 2006-2016 who underwent primary vulvar surgery and evaluation of groin lymph node status. Tumors were reviewed by an experienced gynecologic pathologist. p16 and p53 protein expression by immunohistochemistry and HPV status were analyzed in 116 tumors. Clinicopathologic parameters, protein expression and HPV status were analyzed for association with progression-free and overall survival (PFS, OS). p16 expression and aberrant p53 were found in 49 (42%) and 61 (53%) tumors, respectively. Sixty-six tumors were HPV-associated (57%). Relapse was diagnosed in 35/126 (28%) of patients, and 23 (18%) died of disease. Tumor diameter > 4 cm (p = 0.013), lymphovascular space invasion (LVSI; p < 0.001), the presence of lichen sclerosus (p = 0.019), p16 expression (p = 0.007), p53 expression (p = 0.012), HPV status (p = 0.021), lymph node metastasis (p < 0.001) and post-operative radiotherapy (p < 0.001) were significantly related to OS in univariate analysis. Tumor diameter > 4 cm (p = 0.038), LVSI (p = 0.003), the presence of lichen sclerosus (p = 0.004), p16 expression (p = 0.004), HPV status (p = 0.039), lymph node metastasis (p < 0.001) and post-operative treatment (p < 0.001), were significantly related to PFS in univariate analysis. Age, BMI and surgical resection involvement were not significantly associated with OS or PFS. In multivariate Cox analysis, LVSI and p16 expression were independent prognosticators of OS (p < 0.001 and p = 0.02, respectively) and PFS (p = 0.018, p = 0.037). In conclusion, LVSI and p16 expression are independent prognostic factors in stage I vSqCC.
Topics: Humans; Female; Vulvar Neoplasms; Carcinoma, Squamous Cell; Middle Aged; Aged; Cyclin-Dependent Kinase Inhibitor p16; Biomarkers, Tumor; Neoplasm Staging; Lymphatic Metastasis; Aged, 80 and over; Adult; Neoplasm Invasiveness; Tumor Suppressor Protein p53; Immunohistochemistry; Prognosis; Papillomavirus Infections; Retrospective Studies; Progression-Free Survival
PubMed: 37843640
DOI: 10.1007/s00428-023-03670-y -
Plant Disease Aug 2023Potato cyst nematodes (PCNs; Globodera spp.) cause significant losses in worldwide cultivated potato (Solanum tuberosum) crops. In Colombia, PCN was first reported in...
Potato cyst nematodes (PCNs; Globodera spp.) cause significant losses in worldwide cultivated potato (Solanum tuberosum) crops. In Colombia, PCN was first reported in 1970 (Baeza 1972), although this report lacked a comprehensive species description and diagnosis. After that, G. pallida has been the only PCN species reported affecting potatoes in the main producing regions of Colombia (Evans et al. 1975; Nieto et al. 1983; Vallejo et al. 2021). However, in the survey conducted by Vallejo et al. (2021), a single sample from Chocontá, Cundinamarca in the central region of the country (N 5,22396046668291, W -73,6571338400244) showed molecular characters similar to G. rostochiensis. As correct identification is essential for effective pest management, the location was re-sampled in September 2022. From the soil samples collected, PCN cysts and second-stage juveniles (J2s) were retrieved from soil using Fenwick and centrifugation methods, respectively. Morphometric characters of cysts (n = 53) were consistent with G. rostochiensis, with a length without neck (L) ranging from 451 to 614 μm (X̅ = 546.9 ± 20.3 μm), width (W) from 424 to 658 μm (X̅ = 546.9 ± 25.5 μm) and L/W ratio was 1.00 ± 0.02. Distance from anus to vulva varied from 41 to 109 μm (X̅ =75.67 ± 13.8 μm), Granek's ratio from 2.3 to 5.5 μm (X̅ = 3.89 ± 0.7 μm), and the number of cuticular ridges between the vulva and the anus were 14 to 20 (X̅ = 16.19 ± 1.7). The second-stage juvenile (n = 90) length ranged from 394 to 547 μm (X̅ = 495.62 ± 31.0 μm), the stylet length varied from 18 to 24 μm (X̅ = 21.21 ± 0.9 μm) with rounded knobs. The length of the hyaline tail ranged from 20 - 31 μm (X̅ = 24.09 ± 1.92) and the true tail from 31- 56 μm (X̅ = 48.30 ± 5.71 μm). Molecular analyses confirmed morphological identification. DNA was extracted from cysts and J2s. PCR was performed for the 28S rDNA D2-D3 segment using primers D2A and D3B (Subbotin et al. 2006), and for the mitochondrial COI gene region using primers JB3 and JB5 (Derycke et al. 2005). BLAST analyses of target 28S rDNA D2-D3 sequences (OP293373-OP293380) showed 100% identity of the 658 bp to other sequences on Genbank, including isolates from Turkey, United Kingdom, and Iran (MK311329.1, MG994942.1, KU297659.1, and KU297658.1). Similarly, the target COI region sequences (OP297993-OP298001) were 100% identical to the 407 bp of G. rostochiensis POT01 isolate from Germany, and 99.75% identical to voucher NRM67 from Indonesia, and isolate CD2200 from USA (MF773722.1, MT240262.1, and MN095979.1). Phylogenetic analysis of both gene regions strongly supported G. rostochiensis, with the Colombian sequences clustering with MH399815.1, and KU297654.1 isolates for the COI and 28S regions, respectively (Fig. 1S). In addition, a pathogenicity test was conducted in the greenhouse. For this, ten cysts were inoculated to potato plants of Criolla variety grown in 5 pots of 15 cm diameter with sterile soil and sand (1:1). Noninoculated plants served as controls (three replicates each). After three months, 54 ± 23 cysts/100 g of soil were isolated from inoculated plants (Fig. 2S), resulting in a reproduction factor (R=Pf/Pi) of 4.54 ± 0.86, while no yellow females or cysts were observed on the control plants. To our knowledge, this is the first report of G. rostochiensis in Colombia. This is an important pest that causes serious yield losses of potatoes and is a quarantine nematode in many countries (EPPO 2017). Further studies are necessary to prevent the spread of this PCN species in the main producing potato regions of Colombia.
PubMed: 37531075
DOI: 10.1094/PDIS-04-23-0751-PDN -
The British Journal of General Practice... Jun 2024Vulvovaginal Candidiasis (VVC) is a fungal infection causing inflammation of the vagina and/or the vulva. Symptoms include itching, irritation, and discharge. VVC... (Comparative Study)
Comparative Study Review
BACKGROUND
Vulvovaginal Candidiasis (VVC) is a fungal infection causing inflammation of the vagina and/or the vulva. Symptoms include itching, irritation, and discharge. VVC presents commonly across primary care and, despite its mild symptoms, carries psychological burden and has a significant impact on women's quality of life. UK guidelines support treatment via oral or topical azole antifungal agents. Recent evidence attests to the superiority of novel non-azole antifungals. Thus, rigorous financial assessment of both antifungals is necessary for optimal VVC treatment allocation in UK primary care.
AIM
To evaluate the cost-effectiveness of ibrexafungerp against the gold standard fluconazole as first-line treatment of VVC within the NHS.
METHOD
A systematic review on the efficacy of ibrexafungerp and fluconazole in acute VVC was conducted. Cost-effectiveness analysis was initiated using health outcome data from the DOVE trial, a Phase 2 RCT. Costs in pound sterling were ascertained in monetary units, and effectiveness determined as reduced need for follow-up medication.
RESULTS
An incremental cost-effectiveness ratio of £2185.74 was determined. This suggests oral ibrexafungerp being largely more costly yet slightly more effective than fluconazole, and thus has unfavourable net benefit. Two sensitivity analyses were conducted considering follow-up medication combination and market price, which provided confidence in the calculated cost-effectiveness ratio.
CONCLUSION
This analysis highlights fluconazole's cost-effectiveness in current UK guidelines and favourability.
Topics: Humans; Fluconazole; Female; Cost-Benefit Analysis; Candidiasis, Vulvovaginal; Antifungal Agents; Administration, Oral; United Kingdom; Amphotericin B; State Medicine; Primary Health Care; Acute Disease; Treatment Outcome; Cost-Effectiveness Analysis; Glycosides; Triterpenes
PubMed: 38902100
DOI: 10.3399/bjgp24X738189 -
Parasites & Vectors Oct 2023Nematodes of the genus Heterorhabditis are important biocontrol agents as they form a lethal combination with their symbiotic Photorhabdus bacteria against agricultural...
Taxonomic and molecular characterization of a new entomopathogenic nematode species, Heterorhabditis casmirica n. sp., and whole genome sequencing of its associated bacterial symbiont.
BACKGROUND
Nematodes of the genus Heterorhabditis are important biocontrol agents as they form a lethal combination with their symbiotic Photorhabdus bacteria against agricultural insect pests. This study describes a new species of Heterorhabditis.
METHODS
Six Heterorhabditis nematode populations were recovered from agricultural soils in Jammu and Kashmir, India. An initial examination using mitochondrial and nuclear genes showed that they belong to a new species. To describe this new species, a variety of analyses were conducted, including reconstructing phylogenetic relationships based on multiple genes, characterizing the nematodes at the morphological and morphometric levels, performing self-crossing and cross-hybridization experiments, and isolating and characterizing their symbiotic bacteria.
RESULTS
The newly discovered species, Heterorhabditis casmirica n. sp., shares 94% mitochondrial cytochrome C oxidase subunit I gene (COI) sequence identity with Heterorhabditis bacteriophora and Heterorhabditis ruandica, and 93% with Heterorhabditis zacatecana. Morphologically, it differs from H. bacteriophora in its infective juvenile phasmids (present vs. inconspicuous) and bacterial pouch visibility in the ventricular portion of the intestine (invisible vs. visible); genital papilla 1 (GP1) position (at manubrium level vs. more anterior), and in its b ratio (body length/neck length), c ratio (tail length/bulb width), and D% [(excretory pore/neck length) × 100]. Other morphological differences include anterior end to the nerve ring distance (77-100 vs. 121-130 μm), V% [(anterior end of vulva/body length) × 100] (46-57 vs. 41-47) in hermaphroditic females; rectum size (slightly longer than the anal body diameter vs. about three times longer), phasmids (smaller vs. inconspicuous), body length (0.13-2.0 vs. 0.32-0.39 mm), body diameter (73-150 vs. 160-220 μm), anterior end to the excretory pore distance (135-157 vs. 174-214 μm), and demanian ratios in amphimictic females. Morphological differences with H. ruandica and H. zacatecana were also observed. Furthermore, H. casmirica n. sp. did not mate or produce fertile progeny with other Heterorhabditis nematodes reported from India. It was also discovered that H. casmirica n. sp. is associated with Photorhabdus luminescence subsp. clarkei symbiotic bacteria.
CONCLUSIONS
The discovery of H. casmirica n. sp. provides novel insights into the diversity and evolution of Heterorhabditis nematodes and their symbiotic bacteria. This new species adds to the catalog of entomopathogenic nematodes in India.
Topics: Female; Animals; Rhabditoidea; Phylogeny; Nematoda; Photorhabdus; Whole Genome Sequencing
PubMed: 37880744
DOI: 10.1186/s13071-023-05990-z -
Infection and Drug Resistance 2023This study aims to analyze the distribution of human papillomavirus (HPV) genotypes and the associations of demographic characteristics with HPV infection among women...
PURPOSE
This study aims to analyze the distribution of human papillomavirus (HPV) genotypes and the associations of demographic characteristics with HPV infection among women with condyloma acuminatum (CA) in Henan Province of China.
METHODS
From January 2019 to October 2022, 702 women with CA were sampled for HPV subtypes and surveyed by questionnaire at Henan Provincial People's Hospital. The HPV genotype was tested by flow-through hybridization after polymerase chain reaction (PCR).
RESULTS
The location of warts was mainly vulva. The age of the subjects was mainly distributed in the 20-29-year-old, followed by 30-39-year-old. The most common subtypes were HPV 6 (43.59%), 11 (24.93%), 16 (11.82%), 52 (7.83%), 58 (7.55%), 51 (7.26%), 61 (5.70%), 39 (5.56%), 18 (5.13%), and 54 (4.70%), our results also suggested that HPV 6 and 11 were the dominant genotypes in each age group. The infection of low-risk HPV (LR-HPV) (74.50%) and single HPV (47.01%) were the main categories. In terms of educational level, women with senior high school or above were inclined to infect single and pure-LR HPV. Unmarried status, sometimes or never condom use increased the chances of multiple, pure high-risk (HR) and mixed HPV infections. Women with multiple sex partners were more likely to cause multiple and mixed HPV infections.
CONCLUSION
Our experimental data on the prevalence and subtype distribution of HPV in women with CA could provide valuable reference for preventing CA in Henan Province. The application of the nine-valent vaccine provides a broad prospect for female CA prevention.
PubMed: 37534063
DOI: 10.2147/IDR.S418783 -
International Journal of Cancer Jul 2024Human papillomavirus (HPV) proteins may elicit antibody responses in the process toward HPV-related malignancy. However, HPV seroepidemiology in noncervical HPV-related...
Human papillomavirus (HPV) proteins may elicit antibody responses in the process toward HPV-related malignancy. However, HPV seroepidemiology in noncervical HPV-related cancers remains poorly understood, particularly in populations with a high prevalence of human immunodeficiency virus (HIV). Using a glutathione S-transferase-based multiplex serology assay, antibodies against E6, E7 and L1 proteins of HPV16 and HPV18 were measured in sera of 535 cases of noncervical HPV-related cancers (anal (n = 104), vulval (n = 211), vaginal (n = 49), penile (n = 37) and oropharyngeal (n = 134)) and 6651 non-infection-related cancer controls, from the Johannesburg Cancer Study that recruited Black South African with newly diagnosed cancer between 1995 and 2016. Logistic and Poisson regression models were used to calculate adjusted odds ratios (aOR) and prevalence ratios (aPR) and 95% confidence intervals (CI) in cases versus controls. HPV16 E6 was more strongly associated with noncervical HPV-related cancers than HPV16 L1 or E7, or HPV18 proteins: anal (females (HPV16 E6 aOR = 11.50;95%CI:6.0-22.2), males (aOR = 10.12;95%CI:4.9-20.8), vulval (aOR = 11.69;95%CI:7.9-17.2), vaginal (aOR = 10.26;95%CI:5.0-21), penile (aOR = 18.95;95%CI:8.9-40), and oropharyngeal (females (aOR = 8.95;95%CI:2.9-27.5), males (aOR = 3.49;95%CI:1.8-7.0)) cancers. HPV16-E6 seropositivity ranged from 24.0% to 35.1% in anal, vulval, vaginal and penile cancer but was significantly lower (11.2%) in oropharyngeal cancer. After adjustment for HIV, prevalence of which increased from 22.2% in 1995-2005 to 54.1% in 2010-2016, HPV16 E6 seropositivity increased by period of diagnosis (aPR for 2010-2016 vs. 1995-2006 = 1.84;95%CI:1.1-3.0). Assuming HPV16 E6 seroprevalence reflects HPV attributable fraction, the proportion of certain noncervical-HPV-related cancers caused by HPV is increasing over time in South Africa. This is expected to be driven by the increasing influence of HIV.
Topics: Humans; Male; Female; South Africa; Papillomavirus Infections; Middle Aged; Adult; Antibodies, Viral; Oncogene Proteins, Viral; HIV Infections; Human papillomavirus 16; Aged; Oropharyngeal Neoplasms; Seroepidemiologic Studies; Case-Control Studies; Human papillomavirus 18; Vulvar Neoplasms; Penile Neoplasms; Anus Neoplasms; Vaginal Neoplasms; Black People; Repressor Proteins; Neoplasms; Human Papillomavirus Viruses
PubMed: 38577820
DOI: 10.1002/ijc.34919 -
Cancer Causes & Control : CCC May 2024Populations with high cancer risk that are targeted for screening, education, and vaccination have been shown to increase rates of screening, which ultimately may...
PURPOSE
Populations with high cancer risk that are targeted for screening, education, and vaccination have been shown to increase rates of screening, which ultimately may improve timing of diagnosis and overall outcome for certain cancers. Spatial scan analysis provides a visual representation of areas with higher rates of disease. Limited research has used this methodology to assess HPV-associated cancers. Using, spatial scan statistics, our goal was to identify regions within Kentucky having significantly higher rates of HPV-associated tumors. These regions can be targeted for public health efforts in the form of education, vaccination, screening, and physician recruitment.
METHODS
The Kentucky Cancer Registry data from 1995 to 2016 and spatial scan statistics were used to identify county-level clusters with high-incidence of HPV-associated cancers after adjustment for age and sex. Anatomic sites included in this analysis were oropharynx, cervix, anus, penis, and vulva.
RESULTS
There was one high-rate cluster of oropharyngeal cancer, which was observed in the Louisville metropolitan region (Relative Risk [RR] = 1.24, p < 0.001). One high-rate cluster of anal and penile cancer incidence in men was identified that partially overlapped with the oropharyngeal cluster. There were five clusters of higher cervical, vulvar, and anal cancer incidence in females, one of which overlapped with the oropharyngeal cluster.
CONCLUSION
Overlapping clusters of HPV-associated cancers were identified at the county-level and included both urban and rural counties of Kentucky. Findings can assist in the design of public health interventions to increase screenings, promote vaccination, and recruit physicians in these regions to improve prevention, diagnosis, and early treatment of HPV-associated cancers.
Topics: Humans; Kentucky; Female; Papillomavirus Infections; Male; Incidence; Middle Aged; Adult; Registries; Papillomaviridae; Neoplasms; Aged; Spatial Analysis
PubMed: 38212533
DOI: 10.1007/s10552-023-01835-3 -
Journal of Nematology Feb 2023Pigeons are a cosmopolitan group of birds with abundant and large populations associated with human activities. This study focused on determining parasitic infections...
Pigeons are a cosmopolitan group of birds with abundant and large populations associated with human activities. This study focused on determining parasitic infections within domestic pigeons (). Forty-eight pigeons were examined for infections, of which 29.16% were infected with a nematode parasite, identified as (Habronematidae), under the koilin layer of their gizzards. The population of nematodes in infected gizzards did not exceed 20 adult worms. DNA from the gizzard worms was extracted and subjected to PCR using primers that amplify the partial 18S rDNA and cytochrome C oxidase subunit I (COX I) regions. Identification of this parasite based on microscopic study revealed the presence of trilobed lips with cephalic papillae and amphidial pores, as well as other characteristic features. In males, spicules were unequal with the presence of six pedunculated pairs of caudal papillae (4 pre- and 2 post-anal) and a tail surrounded with caudal ala. In females, the vulva was a rounded aperture located in front of the posterior end of the esophagus and uteri, which was filled with numerous embryonated eggs. DNA Sequences from partial 18S rDNA were homologous to sequences obtained from in GenBank with a high percentage of identity. DNA sequences from mitochondrial gene COX I, however, were unique, and they were the first sequenced for , since no sequences for this taxon were previously available in GenBank. Histopathological examination revealed enlargement of infected gizzards in comparison to non-infected ones, with the presence of necrosis and interstitial infiltration in the koilin layer. Concentrations of heavy metals (Fe, Cu, Zn, Cd, Cr, and Co) were measured using inductivity-coupled plasma in tissues (liver, muscles, and gizzards) from infected and non-infected pigeons as well as their parasites. Results showed different affinities of metals to tissues. Recovered parasites can minimize element concentration from their pigeon tissues. In Saudi Arabia, this study was considered the first report identifying pigeon nematodes and evaluating of the effects of their pathogenicity on the animals' welfare, as well as their application as a useful tool for monitoring environmental pollution.
PubMed: 38026547
DOI: 10.2478/jofnem-2023-0050 -
Frontiers in Oncology 2023A large-sample study focusing on VIN lesions of a more precise thickness is needed to help guide clinical treatment. This study aimed to investigate the depth of vulvar...
INTRODUCTION
A large-sample study focusing on VIN lesions of a more precise thickness is needed to help guide clinical treatment. This study aimed to investigate the depth of vulvar intraepithelial neoplasia (VIN) and involved skin appendages to provide evidence for laser surgery.
METHODS
The study retrospectively enrolled and analyzed the clinical characteristics of VIN patients in the obstetrics and gynecology department of a university hospital between January 1, 2019 and December 30, 2021. The study further explored the thickness of epithelium and skin appendages of 285 women with low-grade VIN (VIN1) and 285 women with high-grade VIN (VIN2/3).
RESULTS
The study included 1,139 (80%) VIN1 and 335 (20%) VIN2/3 cases. The VIN1 and VIN2/3 groups showed a significant difference in human papillomavirus infection (P<0.01) but not in cytology (P = 0.499). Most (89.90%, 1,325) cases occurred in one area of the vulva, whereas 10.11% were multifocal. VIN commonly occurred on the posterior fourchette (76.85%), labia majora (11.61%), and labia minora (9.92%). The VIN2/3 group reported a significantly higher positive rate for concurrent cervical and vaginal intraepithelial neoplasia (160 of 285) than the VIN1 group (321 of 953) (P=0.000). The involved epithelial thicknesses in VIN2/3 and VIN1 were 0.69 ± 0.44 and 0.49 ± 0.23 mm, respectively, both of which were greater than the corresponding noninvolved epithelial thickness (0.31 ± 0.19 and 0.32 ± 0.10 mm, P<0.001 and P<0.001, respectively). In cases of appendage involvement, the VIN thickness was 1.98 ± 0.64 mm.
CONCLUSIONS
VIN thickness was generally ≤1 mm for the superficial lesions in non-hairy areas. However, for lesions extending onto hairy areas, the thickness was approximately 3 mm, leading to the destruction of involved skin appendages.
PubMed: 37854683
DOI: 10.3389/fonc.2023.1254820 -
Plant Disease Jan 2024Coral dealbatus belonging to Crassulaceae, is a new kind of health care vegetable as both medicine and food (Qin et al., 2022). Because of its obvious health care...
Coral dealbatus belonging to Crassulaceae, is a new kind of health care vegetable as both medicine and food (Qin et al., 2022). Because of its obvious health care function, C. dealbatus was widely cultivated in China and market demand increased quickly. In August of 2022, a large number of C. dealbatus showed the symptoms of stunting and leaf yellowing in Dali county, Weinan, Shaanxi province, China (109°43'E, 34°36'N). Many galls were observed on the roots of infected plants, and females were observed under the plant epidermis. Infected roots and soil samples were collected, the females, males and second-stage juveniles (J2s) were isolated. The female had a spherical body with a protruding neck, the stylet of females was slender and curved toward the back slightly. The perineal pattern of female (n=20) was round or elliptical, with high and squared dorsal arch, without obvious lateral lines. Morphological measurements of females (n=20): body length (L)=782.09±54.54 ( 518.52 to 1137.76) μm, body width (W)=439.51±19.23 (336.51 to 551.74 ) μm, stylet length (ST)=15.39±0.67 (12.55 to 18.80) μm, stylet knob height (STKH)=2.02±0.09 (1.88 to 2.46) μm, stylet knob width (STKW)=3.69±0.15 (2.91to 4.58) μm, distance from dorsal esophageal gland orifice to base of stylet (DGO)=2.32±0.17 (1.77 to 3.48) μm, vulval slit length (V)=23.99±0.75 (20.71 to 28.83) μm, and vulval slit to anus distance (V') = 18.62±0.55 (14.95 to 21.20) μm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and had blunt tail that bended slightly towards the abdomen, stylet knobs were prominent, speculum were in pairs and acicular. Measurements of females (n=10) were: L=1377.82±198.09 (1040.66 to 1726.59) μm, W=37.32±4.49 (28.35 to 41.90) μm, ST=21.48±1.23 (19.69 to 23.51) μm, STKH=2.99±0.12 (2.82 to 3.23) μm, STKW=5.34±0.41 (4.64 to 6.06) μm, DGO=2.54±0.13 (2.31 to 2.77) μm. J2s had the following characteristics: L=435.57±40.75 (414.92 to 462.14) μm, W=16.73±2.62 (12.76 to 21.95) μm, ST=12.66±1.02 (10.68 to 14.76) μm, STKH=1.58±0.29 (1.07 to 1.98) μm, STKW=2.22±0.38 (1.63 to 2.70) μm, DGO=2.26±0.18 (2.03 to 2.70) μm, tail length(T)= 87.97±9.71 (72.98 to 92.53) μm, hyaline tail terminus (HT) = 12.44±2.21 (9.59 to 13.90) μm. The nematode had uniform morphological characteristics with Meloidogyne incognita (Orton Williams, 1973). DNA was extracted from ten single females, and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for identification of M. incognita (Kiewnick et al., 2013), and a 300bp fragment was amplified by this pair of primers, confirming the nematode was M. incognita. 18S rDNA gene was amplified using the primer pair 18S/26S (TTTCACTCGCCGTTACTAAGG/TTGATTACGTCCCTGCCCTTT) (Vrain et al.,1992), and the sequence was submitted to GenBank (GenBank Accession No. OR477177). Sequence aligment was conducted and showed 100% identical with the known sequence of M. incognita (GenBank Accession Nos. MH113856 and OQ269709). The result of identification was also confirmed by amplifying the sequence of NADH dehydrogenase subunit 5 (nad5) from mitochondrial DNA region using primers: NAD5-F/R(TATTTTTTGTTTGAGATATATTAG/TCGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A611bp fragment was amplified and the sequence (GenBank Accession No. OR520436) showed 100% identical with other M. incognita sequences (GenBank Accession Nos. OP753345 and MT683461). In order to determine the pathogenicity of the nematode, infestation test was conducted in greenhouse. Ten 20-day-old healthy plants were cultured in pots with sterilized soil respectively and 2000 J2 hatched from egg masses of M. incognita were inoculated to the root of the plant. Five non-inoculated healthy C. dealbatus were used as negative control. After cultured at 25℃ for 60 days, roots were galled as observed in the field, and the symptoms of the root inoculated artificially with M. incognita were the same as those in the field. The nematodes were collected from inoculated roots, and identified as M. incognita with the species-specific primers Mi2F4/Mi1R1. An average of 7362 J2 was recovered and the reproduction factor value was 3.68. No galls were observed in control plants. These results suggested that C. dealbatus is a host for M. incognita. To our knowledge, this is the first report of M. incognita parasitizing C. dealbatus. This finding may be important to C. dealbatus industry and appropriate strategies should be taken to deal with the spreading of M. incognita.
PubMed: 38190365
DOI: 10.1094/PDIS-09-23-1968-PDN