-
Scientific Reports Mar 2024The purpose of this paper is to expand on the phenotype of oculocutaneous albinism type 7 (OCA7). We described three patients with OCA7: two from a consanguineous family...
The purpose of this paper is to expand on the phenotype of oculocutaneous albinism type 7 (OCA7). We described three patients with OCA7: two from a consanguineous family of Kurdish origin and one patient of Dutch origin. We compared them with all patients described to date in the literature. All newly described patients had severely reduced visual acuity (VA), nystagmus, hypopigmentation of the fundus, severe foveal hypoplasia, and chiasmal misrouting. None had iris translucency. All patients had normal pigmentation of skin and hair. We found one novel mutation in the Dutch patient: c.565G > A; p.(Gly189Ser). We compared our patients to the 15 described in the literature to date. All 18 patients had substantially pigmented skin and hair, very poor VA (0.4-1.3 logMAR), nystagmus, (mild) ocular hypopigmentation, foveal hypoplasia, and misrouting. Although pigmentation levels were mildly affected in OCA7, patients had a severe ocular phenotype with VA at the poorer end of the albinism spectrum, severe foveal hypoplasia, and chiasmal misrouting. OCA7 patients had a phenotype restricted to the eyes, and similar to that of X-linked ocular albinism. We therefore propose to rename the disorder in ocular albinism type 2. Unfolding the role of LRMDA in OCA7, may bring us a step closer in identifying the responsible factors for the co-occurrence of foveal hypoplasia and misrouting.
Topics: Humans; Albinism, Ocular; Albinism, Oculocutaneous; Nystagmus, Pathologic; Hypopigmentation; Retina; Mutation; Vision Disorders
PubMed: 38555393
DOI: 10.1038/s41598-024-57969-0 -
JAAD Case Reports Nov 2023
PubMed: 37842156
DOI: 10.1016/j.jdcr.2023.08.023 -
Medecine Tropicale Et Sante... Dec 2023Oculocutaneous albinism (OCA) is genetically transmitted. In this paper we advocate for this disease to be included in the NTD list of the WHO. OCA type 2 is the most...
Oculocutaneous albinism (OCA) is genetically transmitted. In this paper we advocate for this disease to be included in the NTD list of the WHO. OCA type 2 is the most common form of albinism in sub-Saharan Africa, with a prevalence of 1 in 7900 among the Bamileke of Cameroon, 1 in 3900 in South Africa and 1 in 1100 among the Ibos of Nigeria, as compared to a prevalence of 1 in 10,000 among African Americans and 1 in 36,000 among White Americans and Europeans. The medical problems related to ophthalmological aspects (poor visual acuity, ametropia, nystagmus, photophobia) and dermatological aspects of albinism (sensitivity to UV rays from the sun and development of skin cancers) are well known. However, their management is often challenging for persons with albinism in sub-Saharan Africa because of their financial burden and the difficulty of accessing medical specialists. In many African countries, persons with albinism are also very often the subject of social, cultural, medical, moral and economic discrimination, which can limit their access to education, employment and community life. They are considered 'white Africans', intermediary and incomplete, with innate powers for good and evil. This particularity has made persons with albinism the targets of mutilations and/or ritual attacks for the purposes of using their body parts in the preparation of charms to bring good luck, health or prosperity. On 13 June 2013, as a result of lobbying by the Canadian NGO Under the Same Sun and African albinism associations, United Nations bodies including UNESCO and the WHO (World Health Organization) responded and a Resolution addressing the discrimination and attacks was voted in. The date has since become International Albinism Awareness Day and is celebrated on a different theme each year with great energy and impact, especially by French, English and Portuguese speaking albinism associations across sub-Saharan Africa. In 2015 the Human Rights Council created the position of Independent Expert on Albinism to better collect and analyse data on the rights of persons with albinism around the world, and especially in countries where ritual attacks occur. The data collected by albinism associations and the authorities thus go directly to the UN Human Rights Directorate. Despite this international attention to the attacks on persons with albinism, one of the biggest threats is skin cancer, which very often leads to early death. In 2022, the WHO launched a strategic framework for the control and management of neglected skin-related neglected tropical diseases - an additional reason to include oculocutaneous albinism as an NTD. Although the focus is currently limited to dermatoses of an infectious nature, we argue here for the integration of oculocutaneous albinism among NTDs because the deadliness of these carcinomas in sub-Saharan Africa is well-known and has been examined in a number of medical publications. Here, we propose that oculocutaneous albinism in sub-Saharan Africa be classified as an NTD to help people with albinism have access to health, economic, social and cultural rights.
Topics: Humans; Neglected Diseases; Canada; Albinism, Oculocutaneous; Albinism; South Africa; Skin Neoplasms
PubMed: 38390024
DOI: 10.48327/mtsi.v3i4.2023.434 -
Investigative Ophthalmology & Visual... Oct 2023Albinism is a congenital disorder affecting pigmentation levels, structure, and function of the visual system. The identification of anatomical changes typical for...
PURPOSE
Albinism is a congenital disorder affecting pigmentation levels, structure, and function of the visual system. The identification of anatomical changes typical for people with albinism (PWA), such as optic chiasm malformations, could become an important component of diagnostics. Here, we tested an application of convolutional neural networks (CNNs) for this purpose.
METHODS
We established and evaluated a CNN, referred to as CHIASM-Net, for the detection of chiasmal malformations from anatomic magnetic resonance (MR) images of the brain. CHIASM-Net, composed of encoding and classification modules, was developed using MR images of controls (n = 1708) and PWA (n = 32). Evaluation involved 8-fold cross validation involving accuracy, precision, recall, and F1-score metrics and was performed on a subset of controls and PWA samples excluded from the training. In addition to quantitative metrics, we used Explainable AI (XAI) methods that granted insights into factors driving the predictions of CHIASM-Net.
RESULTS
The results for the scenario indicated an accuracy of 85 ± 14%, precision of 90 ± 14% and recall of 81 ± 18%. XAI methods revealed that the predictions of CHIASM-Net are driven by optic-chiasm white matter and by the optic tracts.
CONCLUSIONS
CHIASM-Net was demonstrated to use relevant regions of the optic chiasm for albinism detection from magnetic resonance imaging (MRI) brain anatomies. This indicates the strong potential of CNN-based approaches for visual pathway analysis and ultimately diagnostics.
Topics: Humans; Optic Chiasm; Artificial Intelligence; Visual Pathways; Albinism; Magnetic Resonance Imaging
PubMed: 37815506
DOI: 10.1167/iovs.64.13.14 -
Journal of Medical Genetics Nov 2023Albinism is a clinically and genetically heterogeneous group of conditions characterised by visual abnormalities and variable degrees of hypopigmentation. Multiple...
Albinism is a clinically and genetically heterogeneous group of conditions characterised by visual abnormalities and variable degrees of hypopigmentation. Multiple studies have demonstrated the clinical utility of genetic investigations in individuals with suspected albinism. Despite this, the variation in the provision of genetic testing for albinism remains significant. One key issue is the lack of a standardised approach to the analysis of genomic data from affected individuals. For example, there is variation in how different clinical genetic laboratories approach genotypes that involve incompletely penetrant alleles, including the common, 'hypomorphic' c.1205G>A (p.Arg402Gln) [rs1126809] variant. Here, we discuss the value of genetic testing as a frontline diagnostic tool in individuals with features of albinism and propose a practice pattern for the analysis of genomic data from affected families.
Topics: Humans; Albinism; Albinism, Oculocutaneous; Genetic Testing; Genotype; Alleles
PubMed: 37460203
DOI: 10.1136/jmg-2022-109088 -
Molecular Vision 2023Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes....
PURPOSE
Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation.
METHODS
A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of . Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations.
RESULTS
Genetic analysis identified 11 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a mutation were found to present a typical or atypical phenotype of OA1. All patients with mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia.
CONCLUSIONS
We discovered seven novel mutations and four previously reported mutations of in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.
Topics: Humans; Albinism, Ocular; Eye Proteins; Genetic Diseases, X-Linked; Iris; Membrane Glycoproteins; Mutation; Nystagmus, Congenital; Pedigree
PubMed: 38222445
DOI: No ID Found -
International Journal For Equity in... Jan 2024Persons with albinism face challenges to their wellbeing, safety, and security, ranging from vision impairment and skin cancer to stigma and discrimination. In some...
BACKGROUND
Persons with albinism face challenges to their wellbeing, safety, and security, ranging from vision impairment and skin cancer to stigma and discrimination. In some regions, they also face human rights atrocities including mutilation and murder. Research on human rights and albinism is a relatively new field that has gained momentum since the United Nations appointment of an Independent Expert on the enjoyment of human rights by persons with albinism. In this paper, we present the results of a mixed methods study undertaken to identify priorities for research, advocacy, and policy on albinism and human rights.
METHODS
The first component was a synthesis of peer-reviewed and grey literatures at the nexus of albinism, spiritual/cultural beliefs and practices, and human rights. We then conducted a priority-setting survey, informed by Delphi methods, on extant knowledge-practice gaps and research, advocacy, and policy priorities. Inclusion criteria included demonstrated expertise in the field (e.g., peer-reviewed publications, funded research), membership on national or international associations, or advocacy (civil society organizations) of more than 2 years in albinism and human rights. Thereafter, we gathered leading researchers, policy-makers, and civil society stakeholders for a Roundtable to gain consensus on these priorities.
RESULTS
Access to skin and vision care, and education were not deemed high priority for research, likely because the evidence supporting the need for these is well established. However, they were priorities for advocacy and policy: what is needed is mobilization of this evidence through advocacy and implementation of such services (policy). Other social determinants of health (rurality, poverty, and gender equality) are present as subtext in the findings, more so than priorities for research, advocacy, or policy, despite their preponderance in the lives of persons with albinism. Research was prioritized on stigma and discrimination; advocacy; and witchcraft, but with some differentiation between Global North and Global South priorities. Priorities for research, advocacy, and policy vary in keeping with the explanatory frameworks at play, including how harmful practices and witchcraft are viewed.
CONCLUSIONS
The lived experience of albinism is profoundly shaped by the social determinants of health (SDOH). Threats to the security and well-being of persons with albinism should be viewed through a human rights lens that encompasses the explanatory frameworks at play.
Topics: Humans; Health Policy; Human Rights; Organizations; Social Determinants of Health; Albinism
PubMed: 38167082
DOI: 10.1186/s12939-023-02064-5 -
Genetics and Molecular Biology 2023Oculocutaneous albinism (OCA) is a heterogeneous group of genetic disorders involving deficiencies in melanin biosynthesis, with consequent skin, hair, and eye...
Oculocutaneous albinism (OCA) is a heterogeneous group of genetic disorders involving deficiencies in melanin biosynthesis, with consequent skin, hair, and eye hypopigmentation. The world prevalence is estimated at 1/17,000, but there is high variability among populations. The affected individuals, besides clinical complications, can suffer from discrimination. The Brazilian population is highly admixed, with isolated and inbred communities. Previous reports indicated the presence of diverse isolated communities with a high prevalence of OCA in Brazil. The present work sought to review and characterize clusters of albinism in this country based on scientific literature search, newspapers, and websites. We identified and characterized 18 clusters, 13 confirmed by scientific studies. Seven clusters are in the Northeast region, with predominant African ancestry, and seven others in indigenous communities, particularly among the Kaingaing in South Brazil. Isolation and inbreeding associated with founder effects seem to be the most plausible explanation. Molecular studies and clinical classification are still limited. Their localization in deprived regions with poor infrastructure makes them particularly vulnerable to the social and clinical consequences of lacking melanin. We reinforce the need for a tailored approach to these communities, including appropriate medical care, social support, and genetic counselling.
PubMed: 38113291
DOI: 10.1590/1678-4685-GMB-2023-0164 -
Blood Advances Oct 2023Linking the genetic background of patients with bleeding diathesis and altered platelet function remains challenging. We aimed to assess how a multiparameter...
Linking the genetic background of patients with bleeding diathesis and altered platelet function remains challenging. We aimed to assess how a multiparameter microspot-based measurement of thrombus formation under flow can help identify patients with a platelet bleeding disorder. For this purpose, we studied 16 patients presenting with bleeding and/or albinism and suspected platelet dysfunction and 15 relatives. Genotyping of patients revealed a novel biallelic pathogenic variant in RASGRP2 (splice site c.240-1G>A), abrogating CalDAG-GEFI expression, compound heterozygosity (c.537del, c.571A>T) in P2RY12, affecting P2Y12 signaling, and heterozygous variants of unknown significance in the P2RY12 and HPS3 genes. Other patients were confirmed to have Hermansky-Pudlak syndrome type 1 or 3. In 5 patients, no genetic variant was found. Platelet functions were assessed via routine laboratory measurements. Blood samples from all subjects and day controls were screened for blood cell counts and microfluidic outcomes on 6 surfaces (48 parameters) in comparison with those of a reference cohort of healthy subjects. Differential analysis of the microfluidic data showed that the key parameters of thrombus formation were compromised in the 16 index patients. Principal component analysis revealed separate clusters of patients vs heterozygous family members and control subjects. Clusters were further segregated based on inclusion of hematologic values and laboratory measurements. Subject ranking indicated an overall impairment in thrombus formation in patients carrying a (likely) pathogenic variant of the genes but not in asymptomatic relatives. Taken together, our results indicate the advantages of testing for multiparametric thrombus formation in this patient population.
PubMed: 37389831
DOI: 10.1182/bloodadvances.2023009860 -
BMC Pediatrics Jun 2024Oculocutaneous albinism (OCA) is a group of autosomal recessive hereditary disorders that affect melanin biosynthesis, resulting in abnormalities in hair, skin, and... (Review)
Review
BACKGROUND
Oculocutaneous albinism (OCA) is a group of autosomal recessive hereditary disorders that affect melanin biosynthesis, resulting in abnormalities in hair, skin, and eyes. Retinopathy of prematurity (ROP) is a proliferative retinopathy mainly observed in premature infants with low birth weight and early gestational age, but it can also affect full-term infants or children with normal weight, particularly in developing countries. The coexistence of ROP and OCA is rare. There is limited documentation regarding treatment approaches, with few studies reporting positive outcomes with laser treatment due to the absence of melanin pigment. This study discusses the treatment challenges in a female infant diagnosed with ROP and OCA, and underscores the importance of genetic analysis in guiding therapeutic decisions for this rare comorbid condition.
CASE PRESENTATION
The study presents a case of ROP occurring concurrently with OCA. Genetic testing revealed two variants, c.727C > T (p.R243C) and c.1832 T > C (p.L611P), in the OCA2 gene, inherited from the patient's mother and father, respectively. The identified mutations were consistent with a diagnosis of OCA2, classified as a subtype of OCA. The patient initially received intravitreal anti-vascular endothelial growth factor (anti-VEGF) injection, followed by laser photocoagulation therapy for a recurrent event. A favorable outcome was observed during the 2-month follow-up period.
CONCLUSIONS
The co-occurrence of ROP and OCA is a rare phenomenon, and this is the first recorded case in the Chinese population. The current case supports the use of laser as the primary treatment modality for ROP in OCA2 patients with partial pigmentation impairment. Furthermore, genetic analysis can aid in predicting the effectiveness of laser photocoagulation in this patient population.
Topics: Humans; Female; Albinism, Oculocutaneous; Retinopathy of Prematurity; Infant, Newborn; Membrane Transport Proteins; Mutation; Angiogenesis Inhibitors; Laser Coagulation; Bevacizumab
PubMed: 38858617
DOI: 10.1186/s12887-024-04864-2