-
International Journal of Systematic and... Mar 2022Strain UY79 was isolated from a root nodule of , collected at the Esteros de Farrapos National Park, Río Negro, Uruguay. Cells were non-motile Gram-variable rods with...
Strain UY79 was isolated from a root nodule of , collected at the Esteros de Farrapos National Park, Río Negro, Uruguay. Cells were non-motile Gram-variable rods with central to subterminal oval to ellipsoidal endospores that swell the sporangia. Growth was observed in the range of 15-42 °C (optimum, 30 °C), pH 5.0-9.0 (optimum, pH 7.0-8.0) and with up to 3 % (w/v) NaCl (optimum, 1-2 %). Strain UY79 was facultative anaerobic, catalase-positive and oxidase-negative. According to the results of 16S rRNA gene sequence analysis, UY79 belongs to the genus and is closely related to MS2379, BD-57, ATCC 842 and PB172, exhibiting 99.4, 99.0, 99.0 and 98.9% sequence identity, respectively. Average nucleotide identity and digital DNA-DNA hybridization values with the most closely related type strains were 74.3-88.6% and 38.2-48.7 %, respectively. Major fatty acids (>10 %) were anteiso-C, iso-C and C. Menaquinones MK-7 and MK-6 were the only isoprenoid quinones detected. Major polar lipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine and an unidentified glycolipid. Spermidine was the predominant polyamine. The DNA G+C content based on the draft genome sequence was 46.34 mol%. Based on the current polyphasic study, UY79 represents a novel species of the genus , for which the name sp. nov. is proposed. The type strain is UY79 (=CCM 9147=CGMCC 1.19038).
Topics: Arachis; Bacterial Typing Techniques; Base Composition; DNA, Bacterial; Fatty Acids; Paenibacillus; Phylogeny; RNA, Ribosomal, 16S; Sequence Analysis, DNA
PubMed: 35324421
DOI: 10.1099/ijsem.0.005294 -
Molecules (Basel, Switzerland) Nov 2023Glycosidases are essential for the industrial production of functional oligosaccharides and many biotech applications. A novel β-galactosidase/α-L-arabinopyranosidase...
Glycosidases are essential for the industrial production of functional oligosaccharides and many biotech applications. A novel β-galactosidase/α-L-arabinopyranosidase (PpBGal42A) of the glycoside hydrolase family 42 (GH42) from KF-1 was identified and functionally characterized. Using NPG as a substrate, the recombinant PpBGal42A (77.16 kD) was shown to have an optimal temperature and pH of 30 °C and 6.0. Using NPαArap as a substrate, the optimal temperature and pH were 40 °C and 7.0. PpBGal42A has good temperature and pH stability. Furthermore, Na, K, Li, and Ca (5 mmol/L) enhanced the enzymatic activity, whereas Mn, Cu, Zn, and Hg significantly reduced the enzymatic activity. PpBGal42A hydrolyzed NP-β-D-galactoside and NP-α-L-arabinopyranoside. PpBGal42A liberated galactose from β-1,3/4/6-galactobiose and galactan. PpBGal42A hydrolyzed arabinopyranose at C20 of ginsenoside Rb2, but could not cleave arabinofuranose at C20 of ginsenoside Rc. Meanwhile, the molecular docking results revealed that PpBGal42A efficiently recognized and catalyzed lactose. PpBGal42A hydrolyzes lactose to galactose and glucose. PpBGal42A exhibits significant degradative activity towards citrus pectin when combined with pectinase. Our findings suggest that PpBGal42A is a novel bifunctional enzyme that is active as a β-galactosidase and α-L-arabinopyranosidase. This study expands on the diversity of bifunctional enzymes and provides a potentially effective tool for the food industry.
Topics: Paenibacillus polymyxa; Lactose; Molecular Docking Simulation; Galactose; Glycoside Hydrolases; Cloning, Molecular; beta-Galactosidase; Hydrogen-Ion Concentration; Substrate Specificity; Paenibacillus
PubMed: 38005185
DOI: 10.3390/molecules28227464 -
BioMed Research International 2020is a plant growth-promoting rhizobacterium that has immense potential to be used as an environmentally friendly replacement of chemical fertilizers and pesticides. In...
is a plant growth-promoting rhizobacterium that has immense potential to be used as an environmentally friendly replacement of chemical fertilizers and pesticides. In the present study, SK1 was isolated from bulbs of . The isolated endophytic strain showed antifungal activities against important plant pathogens like , , , and . The highest percentage of growth inhibition, i.e., 66.67 ± 2.23%, was observed for SK1 against followed by 61.19 ± 3.12%, 60.71 ± 3.53%, and 55.54 ± 2.89% against , , and , respectively. The metabolite profiling of ethyl acetate fraction was assessed through the UHPLC-LTQ-IT-MS/MS analysis, and putative identification was done with the aid of the GNPS molecular networking workflow. A total of 29 compounds were putatively identified which included dipeptides, tripeptides, cyclopeptides (cyclo-(Leu-Leu), cyclo(Pro-Phe)), 2-heptyl-3-hydroxy 4-quinolone, 6-oxocativic acid, anhydrobrazilic acid, 1-(5-methoxy-1H-indol-3-yl)-2-piperidin-1-ylethane-1,2-dione, octadecenoic acid, pyochelin, 15-hydroxy-5Z,8Z,11Z, 13E-eicosatetraenoic acid, (Z)-7-[(2R,3S)-3-[(2Z,5E)-Undeca-2,5-dienyl]oxiran-2-yl]hept-5-enoic acid, arginylasparagine, cholic acid, sphinganine, elaidic acid, gossypin, L-carnosine, tetrodotoxin, and ursodiol. The high antifungal activity of SK1 might be attributed to the presence of these bioactive compounds. The isolated strain SK1 showed plant growth-promoting traits such as the production of organic acids, ACC deaminase, indole-3-acetic acid (IAA), siderophores, nitrogen fixation, and phosphate solubilization. IAA production was strongly correlated with the application of exogenous tryptophan concentrations in the medium. Furthermore, inoculation of SK1 enhanced plant growth of two varieties, Tresor and White Heaven, under greenhouse condition. In the light of these findings, the SK1 may be utilized as a source of plant growth promotion and disease control in sustainable agriculture.
Topics: Anti-Infective Agents; Ascomycota; Carbon-Carbon Lyases; Carboxylic Acids; Endophytes; Fusarium; Indoleacetic Acids; Lilium; Nitrogen Fixation; Paenibacillus polymyxa; Plant Diseases; Plant Growth Regulators; Plant Roots; Siderophores; Tandem Mass Spectrometry
PubMed: 32190683
DOI: 10.1155/2020/8650957 -
Microorganisms Jun 2022Maize ( L.) is an important crop in the world and maize sheath blight damages the yield and quality greatly. In this study, an antagonist strain, which exhibited...
Maize ( L.) is an important crop in the world and maize sheath blight damages the yield and quality greatly. In this study, an antagonist strain, which exhibited antagonism against pathogenic fungi of maize and controlled maize banded leaf sheath blight in the field, was effectively isolated and named strain SF05. High cellulase and chitinase activity of the strain were detected in this study, which might contribute to degrading the cell wall of fungi. Furthermore, different resistant genes such as , and were elicited differently by the strain in the leaves and stems of maize. In order to explain the biocontrol mechanism of strain SF05, the genome was sequenced and then the genes involving the biocontrol mechanism including biofilm formation pathways genes, cell wall degradation enzymes, secondary metabolite biosynthesis gene clusters and volatile organic compounds biosynthesis genes were predicted. The study revealed the biocontrol mechanism of strain SF05 preliminary and laid a foundation for further research of biocontrol mechanism of .
PubMed: 35889037
DOI: 10.3390/microorganisms10071318 -
Biology Jul 2022The use of microbial products as natural biocontrol agents to increase a plant's systemic resistance to viral infections is a promising way to make agriculture more...
The use of microbial products as natural biocontrol agents to increase a plant's systemic resistance to viral infections is a promising way to make agriculture more sustainable and less harmful to the environment. The rhizobacterium has been shown to have strong biocontrol action against plant diseases, but its antiviral activity has been little investigated. Here, the efficiency of the culture filtrate of the strain SZYM (Acc# ON149452) to protect squash ( L.) plants against a (ZYMV, Acc# ON159933) infection was evaluated. Under greenhouse conditions, the foliar application of the culture filtrate of SZYM either in protective or curative treatment conditions enhanced squash growth, reduced disease severity, and decreased ZYMV accumulation levels in the treated plants when compared to the non-treated plants. The protective treatment group exhibited the highest inhibitory effect (80%), with significant increases in their total soluble carbohydrates, total soluble protein content, ascorbic acid content, and free radical scavenging activity. Furthermore, a considerable increase in the activities of reactive oxygen species scavenging enzymes (superoxide dismutase, polyphenol oxidase, and peroxidase) were also found. In addition, the induction of systemic resistance with a significant elevation in the transcriptional levels of polyphenolic pathway genes (, , and ) and pathogenesis-related genes ( and ) was observed. Out of the 14 detected compounds in the GC-MS analysis, propanoic acid, benzenedicarboxylic acid, tetradecanoic acid, and their derivatives, as well as pyrrolo [1,2-a] pyrazine-1,4-dione, hexahydro-3-(2-methylpropyl) were the primary ingredient compounds in the ethyl acetate extract of the SZYM-culture filtrate. Such compounds may act as elicitor molecules that induce systemic resistance against viral infection. Consequently, can be considered a powerful plant growth-promoting bacterium (PGPB) in agricultural applications as well as a source of bioactive compounds for sustainable disease management. As far as we know, this is the first time that has been shown to fight viruses in plants.
PubMed: 36009777
DOI: 10.3390/biology11081150 -
International Journal of Molecular... Apr 2022With numerous industrial applications, has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression...
With numerous industrial applications, has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was "ACTTAGTTTAAGCAATAGACAAAGT", and this can be degenerated to "ACTTWGTTTAWSSNATAVACAAAGT" in spp., which differs from that in the spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter P. The eGFP fluorescence intensity assay indicated that both the modified and original P had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in spp. that can dynamically regulate its gene circuit strength through xylose.
Topics: Gene Expression; Operon; Paenibacillus; Paenibacillus polymyxa; Xylose
PubMed: 35563415
DOI: 10.3390/ijms23095024 -
Genomics Jan 2021The legislations on the usage of antibiotics as growth promoters and prophylactic agents have compelled to develop alternative tools to upsurge the animal protection and...
The legislations on the usage of antibiotics as growth promoters and prophylactic agents have compelled to develop alternative tools to upsurge the animal protection and contain antibiotic usage. Probiotics have emerged as an effective antibiotic substitute in animal farming. The present study explores the probiotic perspective of Paenibacillus polymyxa HK4 interlinking the genotypic and phenotypic characteristics. The draft genome of HK4 revealed the presence of ORFs encoding the functions associated with tolerance to gastrointestinal stress and adhesion. The biosynthetic gene clusters encoding non-ribosomally synthesized peptides, polyketides and lanthipeptides such as fusaricidin, tridecaptin, polymyxin, paenilan and paenibacillin were annotated in HK4 genome. The strain harbored the chromosomal gene conferring the resistance to lincosamides. No functional gene encoding virulence or toxins could be identified in the genome of HK4. The genome analysis data was complemented by the in vitro experiments confirming its survival during gastrointestinal transit, antimicrobial potential and antibiotic sensitivity. NUCLEOTIDE SEQUENCE ACCESSION NUMBER: The draft-genome sequence of Paenibacillus polymyxa HK4 has been deposited as whole-genome shotgun project at GenBank under the accession number PRJNA603023.
Topics: Anti-Bacterial Agents; Genome, Bacterial; Paenibacillus polymyxa; Polyketides; Polymyxins; Probiotics
PubMed: 33096257
DOI: 10.1016/j.ygeno.2020.10.017 -
Journal of Applied Microbiology Apr 2024In this work, we aimed to isolate marine bacteria that produce metabolites with antifungal properties.
AIMS
In this work, we aimed to isolate marine bacteria that produce metabolites with antifungal properties.
METHODS AND RESULTS
Paenibacillus polymyxa 188 was isolated from a marine sediment sample, and it showed excellent antifungal activity against many fungi pathogenic to plants (Fusarium tricinctum, Pestalotiopsis clavispora, Fusarium oxysporum, F. oxysporum f. sp. Cubense (Foc), Curvularia plantarum, and Talaromyces pinophilus) and to humans (Aspergillus terreus, Penicillium oxalicum, and Microsphaeropsis arundinis). The antifungal compounds produced by P. polymyxa 188 were extracted and analyzed using matrix-assisted laser desorption ionization time-of-flight mass spectrometry. The complete genome sequence and biosynthetic gene clusters of P. polymyxa 188 were characterized and compared with those of other strains. A total of 238 carbohydrate-active enzymes (CAZymes) were identified in P. polymyxa 188. Two antibiotic gene clusters, fusaricidin and tridecaptin, exist in P. polymyxa 188, which is different from other strains that typically have multiple antibiotic gene clusters.
CONCLUSIONS
Paenibacilluspolymyxa 188 was identified with numerous biosynthetic gene clusters, and its antifungal ability against pathogenic fungi was verified.
Topics: Humans; Paenibacillus polymyxa; Antifungal Agents; Anti-Bacterial Agents; Paenibacillus
PubMed: 38509027
DOI: 10.1093/jambio/lxae075 -
Methods in Molecular Biology (Clifton,... 2020The skin contains three primary layers: epidermis, dermis, and hypodermis. Separation of epidermal components from dermis (dermal-epidermal separation) is an important...
The skin contains three primary layers: epidermis, dermis, and hypodermis. Separation of epidermal components from dermis (dermal-epidermal separation) is an important basic investigation technique for pharmacology, toxicology, and biology. There are different systems of epidermal separation, including typical methods of chemical, enzyme, heat, etc. Each approach has advantages versus disadvantages, and thus the appropriate method should be chosen for a given research question. Here we described the method of enzyme separation.
Topics: Bacterial Proteins; Cell Separation; Dermis; Endopeptidases; Epidermal Cells; Humans; Paenibacillus polymyxa; Skin; Trypsin
PubMed: 31792753
DOI: 10.1007/7651_2019_267 -
Frontiers in Microbiology 2022The multiple-sugar metabolism regulator (MsmR), a transcription factor belonging to the AraC/XylS family, participates in polysaccharide metabolism and virulence....
The multiple-sugar metabolism regulator (MsmR), a transcription factor belonging to the AraC/XylS family, participates in polysaccharide metabolism and virulence. However, the transcriptional regulatory mechanisms of MsmR1 in remain unclear. In this study, knocking out was found to reduce polymyxin synthesis by the SC2-M1 strain. Chromatin immunoprecipitation assay with sequencing (ChIP-seq) revealed that most enriched pathway was that of carbohydrate metabolism. Additionally, electromobility shift assays (EMSA) confirmed the direct interaction between MsmR1 and the promoter regions of , , , , , , , and . MsmR1 stimulates polymyxin biosynthesis by directly binding to the promoter regions of and , while also directly regulating and influencing the citrate cycle (TCA cycle). In addition, MsmR1 directly activates and was beneficial for spore and biofilm formation. These results indicated that MsmR1 could regulate carbohydrate and amino acid metabolism, and indirectly affect biological processes such as polymyxin synthesis, biofilm formation, and motility. Moreover, MsmR1 could be autoregulated. Hence, this study expand the current knowledge of MsmR1 and will be beneficial for the application of SC2 in the biological control against the certain pathogens in pepper.
PubMed: 36483206
DOI: 10.3389/fmicb.2022.1039806