-
Polymers Nov 2023The treatment and reuse of wastewater are crucial for the effective utilization and protection of global water resources. Polycyclic aromatic hydrocarbons (PAHs), as one...
The treatment and reuse of wastewater are crucial for the effective utilization and protection of global water resources. Polycyclic aromatic hydrocarbons (PAHs), as one of the most common organic pollutants in industrial wastewater, are difficult to remove due to their relatively low solubility and bioavailability in the water environment. However, biosurfactants with both hydrophilic and hydrophobic groups are effective in overcoming these difficulties. Therefore, a biosurfactant-producing strain MP-6 was isolated in this study to enhance the bioavailability and biodegradation of PAHs, especially high-molecular-weight PAHs (HMW-PAHs). FTIR and LC-MS analysis showed that the MP-6 surfactant belongs to rhamnolipids, a type of biopolymer, which can reduce the water surface tension from 73.20 mN/m to 30.61 mN/m at a critical micelle concentration (CMC = 93.17 mg/L). The enhanced solubilization and biodegradation of PAHs, particularly HMW-PAHs (when MP-6 was introduced), were also demonstrated in experiments. Furthermore, comprehensive environmental stress tolerance tests were conducted to confirm the robustness of the MP-6 biosurfactant, which signifies the potential adaptability and applicability of this biosurfactant in diverse environmental remediation scenarios. The results of this study, therefore, have significant implications for future applications in the treatment of wastewater containing HMW-PAHs, such as coking wastewater.
PubMed: 38232027
DOI: 10.3390/polym15234571 -
Antibiotics (Basel, Switzerland) Nov 2022The emergence of drug resistant microbes over recent decades represents one of the greatest threats to human health; the resilience of many of these organisms can be...
The emergence of drug resistant microbes over recent decades represents one of the greatest threats to human health; the resilience of many of these organisms can be attributed to their ability to produce biofilms. Natural products have played a crucial role in drug discovery, with microbial natural products in particular proving a rich and diverse source of antimicrobial agents. During antimicrobial activity screening, the strain P33 was found to inhibit the growth of multiple pathogens. Following chemical investigation of this strain, pseudopyronines A-C were isolated as the main active principles, with all three pseudopyronines showing outstanding activity against . The analogue pseudopyronine C, which has not been well-characterized previously, displayed sub-micromolar activity against , and . Moreover, the inhibitory abilities of the pseudopyronines against the biofilms of were further studied. The results indicated all three pseudopyronines could directly reduce the growth of biofilm in both adhesion stage and maturation stage, displaying significant activity at micromolar concentrations.
PubMed: 36421300
DOI: 10.3390/antibiotics11111655 -
Nature Communications Feb 2023Natural products largely produced by Pseudomonads-like soil-dwelling microorganisms are a consistent source of antimicrobial metabolites and pesticides. Herein we report...
Natural products largely produced by Pseudomonads-like soil-dwelling microorganisms are a consistent source of antimicrobial metabolites and pesticides. Herein we report the isolation of Pseudomonas mosselii strain 923 from rice rhizosphere soils of paddy fields, which specifically inhibit the growth of plant bacterial pathogens Xanthomonas species and the fungal pathogen Magnaporthe oryzae. The antimicrobial compound is purified and identified as pseudoiodinine using high-resolution mass spectra, nuclear magnetic resonance and single-crystal X-ray diffraction. Genome-wide random mutagenesis, transcriptome analysis and biochemical assays define the pseudoiodinine biosynthetic cluster as psdABCDEFG. Pseudoiodinine biosynthesis is proposed to initiate from guanosine triphosphate and 1,6-didesmethyltoxoflavin is a biosynthetic intermediate. Transposon mutagenesis indicate that GacA is the global regulator. Furthermore, two noncoding small RNAs, rsmY and rsmZ, positively regulate pseudoiodinine transcription, and the carbon storage regulators CsrA2 and CsrA3, which negatively regulate the expression of psdA. A 22.4-fold increase in pseudoiodinine production is achieved by optimizing the media used for fermentation, overexpressing the biosynthetic operon, and removing the CsrA binding sites. Both of the strain 923 and purified pseudoiodinine in planta inhibit the pathogens without affecting the rice host, suggesting that pseudoiodinine can be used to control plant diseases.
Topics: Bacterial Proteins; Pseudomonas; RNA, Untranslated; Operon; Plant Diseases; Oryza
PubMed: 36759518
DOI: 10.1038/s41467-023-36433-z -
Toxics Dec 2023The use of bacteria of the genus -destructors of persistent pollutants for biotechnologies of environmental purification-is an interesting area of research. The aim of...
The use of bacteria of the genus -destructors of persistent pollutants for biotechnologies of environmental purification-is an interesting area of research. The aim of this work was to study the potential of strain 5(3) isolated from pesticide-contaminated soil as a degrader of C-C perfluorocarboxylic acids (PFCAs) and analyze its complete genome. The genome of the strain has been fully sequenced. It consists of a chromosome with a length of 5,676,241 b.p. and containing a total of 5134 genes, in particular, haloalkane dehalogenase gene (), haloacetate dehalogenase H-1 gene (), fluoride ion transporter gene () and alkanesulfonate monooxygenase gene (), responsible for the degradation of fluorinated compounds. The strain 5(3) for was cultivated for 7 days in a liquid medium with various C-C PFCAs as the sole source of carbon and energy, and completely disposed of them. The results of LC-MS analysis showed that the transformation takes place due to perfluorohexanoic acid with the release of various levels of stoichiometry (depending on PFCA) of fluorine ion mineralization indicators determined by ion chromatography. Thus, strain 5(3) demonstrates a genetically confirmed high potential for the decomposition of C-C PFCA.
PubMed: 38133402
DOI: 10.3390/toxics11121001 -
Pest Management Science Apr 2024Aedes aegypti is a widespread mosquito in tropical and subtropical regions that causes significant mortality and morbidity in humans by transmitting diseases, such as...
BACKGROUND
Aedes aegypti is a widespread mosquito in tropical and subtropical regions that causes significant mortality and morbidity in humans by transmitting diseases, such as dengue fever and Zika virus disease. Synthetic insecticides, such as pyrethroids, have been used to control Ae. aegypti, but these insecticides can also affect nontarget organisms and contaminate soil and water. This study aimed to investigate the mosquitocidal activity of Pseudomonas mosselii isolated from pond sludge against larvae of Ae. aegypti.
RESULTS
Based on the initial results, similar time-course profiles were obtained for the mosquitocidal activity of the bacterial culture and its supernatant, and the pellet resuspended in Luria-Bertani (LB) medium also showed delayed toxicity. These results imply that the toxic component can be released into the medium from live bacteria. Further research indicated that the toxic component appeared in the supernatant approximately 4 h after a 3-mL stock was cultured in 200 mL of LB medium. The stabilities of the P. mosselii culture and supernatant stored at different temperatures were also evaluated, and the best culture stability was obtained at 28 °C and supernatant stability at 4 °C. The bacterial culture and supernatant were toxic to larvae and pupae of not only susceptible Ae. aegypti but also pyrethroid-resistant strains.
CONCLUSION
This study highlights the value of the mosquitocidal activity of P. mosselii, which has potential as an alternative insecticide to control pyrethroid-resistant Ae. aegypti in the field. © 2024 Society of Chemical Industry.
PubMed: 38634536
DOI: 10.1002/ps.8139 -
Access Microbiology 2019is the bacterial genus of Gram-negative bacteria with the highest number of recognized species. It is divided phylogenetically into three lineages and at least 11...
is the bacterial genus of Gram-negative bacteria with the highest number of recognized species. It is divided phylogenetically into three lineages and at least 11 groups of species. The group of species is one of the most versatile and best studied. It comprises 15 species with validly published names. As a part of the Genomic Encyclopedia of Bacteria and Archaea (GEBA) project, we present the genome sequences of the type strains of five species included in this group: (DSM 14164), (DSM 17497), (DSM 15088) (DSM 21245) and (DSM 16006). These strains represent species of environmental and also of clinical interest due to their pathogenic properties against humans and animals. Some strains of these species promote plant growth or act as plant pathogens. Their genome sizes are among the largest in the group, ranging from 5.3 to 6.3 Mbp. In addition, the genome sequences of the type strains in the taxonomy were analysed via genome-wide taxonomic comparisons of ANIb, gANI and GGDC values among 130 strains classified within the group. The results demonstrate that at least 36 genomic species can be delineated within the phylogenetic group of species.
PubMed: 32974501
DOI: 10.1099/acmi.0.000067 -
Canadian Journal of Microbiology Jan 2024Cold stress is an important factor limiting rice production and distribution. Identifying factors that contribute to cold tolerance in rice is of primary importance....
Cold stress is an important factor limiting rice production and distribution. Identifying factors that contribute to cold tolerance in rice is of primary importance. While some plant specific genetic factors involved in cold tolerance have been identified, the role of the rice microbiome remains unexplored. In this study, we evaluated the influence of plant growth promoting bacteria (PGPB) with the ability of phosphate solubilization on rice cold tolerance and survival. To reach this goal, inoculated and uninoculated 2-week-old seedlings were cold stressed and evaluated for survival and other phenotypes such as electrolyte leakage (EL) and necessary elements for cold tolerance. The results of this study showed that of the five bacteria, , improved both and varietal plants' survival and decreased EL, indicating increased membrane integrity. We observed different possible cold tolerance mechanisms in and plants such as increases in proline and reduced glutathione levels, respectively. This bacterium also improved the shoot growth of cold exposed plants during the recovery period. This study confirmed the host genotype dependent activity of and indicated that there is an interaction between specific plant genes and bacterial genes that causes different plant responses to cold stress.
Topics: Glutathione; Oryza; Proline; Genotype; Cold Temperature
PubMed: 37699259
DOI: 10.1139/cjm-2023-0030 -
First report of Pseudomonas mosselii causing white blotch disease in Pleurotus pulmonarius in China.Plant Disease Jul 2022Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P....
Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P. pulmonarius, growing in a mushroom farm in Nanning, China. Initially, white blotch (0.7-1.6 cm) appeared on the cap of the young P. pulmonarius, which expanded gradually as the cap grew. However, the fruiting bodies still grew well without rotting. The pathogen causing this phenomenon was isolated from infected cap tissues using a dilution plate technique, sections of tissue (approximately 5×5×5 mm) with white blotch were rinsed three times in sterile deionized water, then, mashed in the sterile 2 ml eppendorf tubes, 1000µl sterile water was added and the suspension was diluted into eight concentrations (10-1~10-8). From each concentration, 120µl suspension was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28°C. Both 10-5 and 10-6 suspensions had single colonies, the dominant single colonies were picked and purified 2-3 times. The purified colonies were round, beige, and opaque, with a raised center and regular, smooth and moist margins. This bacterium is gram negative, short rod-shaped, single polar flagellum, motile, without pods or endospores, and produced fluorescent pigments on King's B medium. Amplified 16S rDNA (1396 bp; OM022022) of four randomly selected colonies using universal primers 27f/1492r, exhibited 100% identity with Pseudomonas (Ps.) mosselii. The partial sequences of the rpoB (1173bp; OM202622), rpoD (734bp; ON469579), gyrB (1383bp; OM202621) and recA (887bp; ON469580) genes of four selected colonies were amplified using primers LAPS5/LAFS27(Tayeb et al. 2005.), PsEG30F/PsEG790R (Mulet et al. 2009), gyrB-R/gyrB-F (Agaras et al. 2018) and recA-F (5'-3' ACGACAACAAGAAGCGCGCCTT)/recA-R (5'-3' CAATGGCCGGGTTCTCTTGCAGGTA) designed in this study, respectively, also exhibited 99%~100% similarities to Ps. mosselii. Phylogenetic analysis showed that isolates cluster with Ps. mosselii. The biochemical tests for isolates were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ps. mosselii (Positive for arginine dihydrolase, trisodium citrate, urea, lysine, arginine, ornithine and gelatin. Negative for glucosamine, lactose, galactose, rhamnose, maltose, sucrose, arabinose, mannose, xylose, esculoside, inositol, nitrate reduction and malonate) (Dabboussi et al.2002; Soto-Rodriguez et al. 2013). The isolates were identified as Ps. mosselii based on biochemical tests and phylogenetic analysis. This isolate was incubated in LB Broth at 28℃, 160 rpm for 24h and the bacterial cells were collected by centrifugation at 4000 rpm for 10min. The collected bacterial cells were resuspended in sterile deionized water to make a bacterial suspension. For pathogenicity tests, 30µl of bacterial suspension (approximately 1x10^9 CFU/mL) was added to the surface of the cap (3-4cm) of young P. pulmonarius. Sterile deionized water was added as a negative control. All treatments were incubated at 22°C and 80-85% humidity. The experiment was repeated three times with three bags each time. 12 h later, white blotches were visible on all parts of the inoculated mushroom. This disease symptoms were similar to those observed in the original samples. However, no disease phenomena were observed in the negative control group. After the pathogenicity test, we obtained the same pathogen as the initially isolates from infected tissues based on morphological characteristics, 16S rDNA sequences, rpoB, rpoD, gyrB and recA sequences, and biochemical test results. Ps. mosselii was first isolated clinically and described by Dabboussi et al. (2002). It has shown to be pathogenic to Oreochromis niloticus and humans (Soto-Rodriguez et al. 2013; Peña et al. 2019; Leneveu-Jenvrin et al. 2013; Huang et al. 2018.). However, to the best of our knowledge, this is the first report of Ps. mosselii causing white blotch disease in P. pulmonarius worldwide, which negatively affects the commercial value of P. pulmonarius and requires attention of mushroom industry.
PubMed: 35822894
DOI: 10.1094/PDIS-01-22-0201-PDN -
Biology Aug 2022The environmental bacterium produces antagonistic secondary metabolites with inhibitory effects on multiple plant pathogens, including the causal agent of bacterial...
The environmental bacterium produces antagonistic secondary metabolites with inhibitory effects on multiple plant pathogens, including the causal agent of bacterial wilt. In this study, an engineered strain was generated to express , which determines the incompatible interactions with tobacco plants. The gene, together with its native promoter, was integrated into the chromosome. The resulting strain showed no difference in antimicrobial activity against . Promoter-LacZ fusion and RT-PCR experiments demonstrated that the gene was transcribed in culture media. Compared with that of the wild type, the engineered strain reduced the disease index by 9.1% for bacterial wilt on tobacco plants. A transcriptome analysis was performed to identify differentially expressed genes in tobacco plants, and the results revealed that ethylene- and jasmonate-dependent defense signaling pathways were induced. These data demonstrates that the engineered expressing can improve biological control against tobacco bacterial wilt by the activation of host defense responses.
PubMed: 36009798
DOI: 10.3390/biology11081170 -
Biology Feb 2022(Lepidoptera: Lycaenidae) and (Lepidoptera: Pyralidae) are the key pests of pomegranates in Saudi Arabia that are managed mainly using broad-spectrum pesticides....
Isolation, Identification, and Biocontrol Potential of Entomopathogenic Nematodes and Associated Bacteria against (Lepidoptera: Lycaenidae) and (Lepidoptera: Pyralidae).
(Lepidoptera: Lycaenidae) and (Lepidoptera: Pyralidae) are the key pests of pomegranates in Saudi Arabia that are managed mainly using broad-spectrum pesticides. Interactions between the entomopathogenic nematodes (EPNs) Steinernematids, and Heterorhabditids, and their entomopathogenic bacterial symbionts (EPBs) have long been considered monoxenic 2-partner associations responsible for killing insects and, therefore, are widely used in insect pest biocontrol. However, there are limited reports identifying such organisms in Taif, Saudi Arabia. The current study aimed to identify the EPNs and their associated bacteria isolated from Taif, Saudi Arabia, and evaluate their biocontrol potential on third instar larvae of and under laboratory conditions. A total of 35 EPN isolates belonging to (20) and (15) were recovered from 320 soil samples. Twenty-six isolates of symbiotic or associated bacteria were isolated from EPNs and molecularly identified as (6 isolates), (4 isolates), (7), or (9). A pathogenicity assay revealed that spp. were more virulent than spp. against the two pomegranate insects, with LC values of 18.5 and 13.6 infective juveniles (IJs)/larva of for spp. and 52 and 32.4 IJs/larva of for spp. at 48 and 72 h post-treatment, respectively. Moreover, LC values of 9 and 6.6 IJs/larva ( spp.) and 34.4 and 26.6 IJs/larva ( spp.) were recorded for larvae at 48 and 72 h post-treatment. In addition, the EPB CQ1, isolated from spp., surpassed SJ10, associated with spp., in their ability to kill or larvae within 6 h post-application, resulting in 100% mortality in both insects after 24 and 48 h of exposure. We conclude that either application of EPNs' IJs or their associated EPBs could serve as potential biocontrol agents for and .
PubMed: 35205161
DOI: 10.3390/biology11020295