-
Microbiology Resource Announcements Jun 2021Paenibacillus polymyxa strain HOB6 was isolated from hemp seed oil. The strain displays antimicrobial activity against fungal pathogens and has potential for development...
Paenibacillus polymyxa strain HOB6 was isolated from hemp seed oil. The strain displays antimicrobial activity against fungal pathogens and has potential for development as a biopesticide against cannabis diseases. Its genome was sequenced and annotated, uncovering the ability to encode the biosynthetic pathways for antimicrobial lanthipeptides and nonribosomal peptides.
PubMed: 34080899
DOI: 10.1128/MRA.00344-21 -
Enzyme and Microbial Technology Mar 2023Recently, there has been increased interest in the synthesis of nanoparticles by using natural polysaccharides. These polysaccharides are eco-friendly, nontoxic, and...
Recently, there has been increased interest in the synthesis of nanoparticles by using natural polysaccharides. These polysaccharides are eco-friendly, nontoxic, and cheap to prepare. On the other hand, the attention in hydrocolloids and films has significantly enhanced, and their application is very promising in the food, pharmaceutical, perfumery and cosmetics, oil, paper, and textile industries. In this context, the present study is aimed to prepare silver nanoparticles by using viscous and superviscous exopolysaccharides of the rhizobacterium Paenibacillus polymyxa strains, CCM 1465 and 88A, and examined the properties of the resultant nanoparticles. We examined the synthesis and properties of silver nanoparticles under variable synthetic conditions by using exopolysaccharides of the rhizobacteria Paenibacillus polymyxa CCM 1465 and 88A. To prepare nanoparticles, we used different combinations of exopolysaccharide and silver nitrate concentrations: 1-10 mg/mL and 1-40 mM, respectively. The resulting solutions were alkalinized from pH 7.5-12 and heated for 15, 30, and 60 min to determine the optimal synthetic conditions. We found that the exopolysaccharides of strains CCM 1465 and 88A reduced silver ions and acted as nanoparticle stabilizers. The prepared spherical, oval, and triangular particles were stable and ranged in size from 2 to 40 nm, depending on the strain and on the experimental conditions. The nanoparticles showed antibacterial and antifungal activity against Escherichia coli K-12, Pseudomonas aeruginosa 50.3, Bacillus subtilis 26-D, and Fusarium oxysporum. In addition, the nanoparticles were active against SK-MEL-2 human melanoma cells. This finding shows the promise of further research on the exopolysaccharides of P. polymyxa 1465 and 88А in different fields of science, including medicine.
Topics: Humans; Paenibacillus polymyxa; Metal Nanoparticles; Escherichia coli K12; Silver; Polysaccharides; Anti-Bacterial Agents; Escherichia coli
PubMed: 36508942
DOI: 10.1016/j.enzmictec.2022.110174 -
The Journal of General and Applied... Dec 2023Bacteria represent an attractive source for the isolation and identification of potentially useful microorganisms for lignin depolymerization, a process required for the...
Bacteria represent an attractive source for the isolation and identification of potentially useful microorganisms for lignin depolymerization, a process required for the use of agricultural waste. In this work, ten autochthonous bacteria isolated from straw, cow manure, and composts were characterized for potential use in the biodelignification of the waste. A comparison of the ability to degrade lignin and the efficiency of ligninolytic enzymes was performed in bacteria grown in media with lignin as a sole carbon source (LLM, 3.5g/L lignin-alkali) and in complex media supplemented with All-Ban fiber (FLM, 1.5g/L). Bacterial isolates showed different abilities to degrade lignin, they decreased the lignin concentration from 7.6 to 18.6% in LLM and from 11.1 to 44.8% in FLM. They also presented the activity of manganese peroxidase, lignin peroxidases, and laccases with different specific activities. However, strain 26 identified as Paenibacillus polymyxa by sequencing the 16S rRNA showed the highest activity of lignin peroxidase and the ability to degrade efficiently lignocellulose. In addition, P. polymyxa showed the highest potential (desirability ≥ 0.795) related to the best combination of properties to depolymerize lignin from biomass. The results suggest that P. polymyxa has a coordinated lignin degradation system constituted of lignin peroxidase, manganese peroxidase, and laccase enzymes.
PubMed: 38104982
DOI: 10.2323/jgam.2023.12.001 -
Animal Nutrition (Zhongguo Xu Mu Shou... Sep 2021With the ever-growing strict prohibitions on antibiotic growth promoters (AGP) in animal production, in-feed probiotics are becoming attractive alternatives to...
With the ever-growing strict prohibitions on antibiotic growth promoters (AGP) in animal production, in-feed probiotics are becoming attractive alternatives to antibiotics in the poultry industry. To investigate the effects of 10 and 16 on the growth performance and intestinal health of broilers, 540 male Cobb 500 broilers of 1 d old were randomly divided into 3 groups with 6 replicates per group and 30 chicks per replicate. Broilers were fed with either a basal diet or basal diets supplemented with 1 × 10 colony-forming units (CFU)/kg 10 (BSC10) or 16 (Lac16) for 42 d. Results showed that Lac16 treatment improved ( < 0.05) the growth performance (body weight and feed conversion) of broilers at the starter phase, while BSC10 treatment slightly improved ( > 0.05) the growth performance of the starter phase broilers. The increased villus height ( < 0.05) at d 14, 21 and 42 and villus height to crypt depth ratio ( < 0.05) at d 14 and 21 were observed in the ileum of the 2 probiotic groups. Besides, transmission electron microscopy results showed that the 2 probiotics enhanced the intestinal epithelial barrier. Both probiotic treatments up-regulated ( < 0.05) the mRNA expression of fatty acid binding protein 1 () and sodium-dependent glucose transporters-1 () in the ileal mucosa of broilers at d 21. In addition, BSC10 and Lac16 treatments significantly ( < 0.05) increased the relative abundance of short-chain fatty acids-producing bacteria, such as , , and , and significantly ( < 0.05) decreased the relative abundance of enteric pathogens (, and ). Furthermore, the 2 probiotic treatments also increased the positive connection among the intestinal microbes and the carbohydrate metabolism-related pathways of the intestinal bacteria ( < 0.05), with decreasing ( < 0.05) nucleotides biosynthesis-related pathways of the intestinal bacteria. Overall, these results suggest that the 2 probiotics, especially Lac16, have a potential beneficial effect on the growth performance and intestinal health of starter phase broilers.
PubMed: 34466687
DOI: 10.1016/j.aninu.2021.03.008 -
Applied and Environmental Microbiology Sep 2023WLY78, a N-fixing bacterium, has great potential use as a biofertilizer in agriculture. Recently, we have revealed that GlnR positively and negatively regulates the...
WLY78, a N-fixing bacterium, has great potential use as a biofertilizer in agriculture. Recently, we have revealed that GlnR positively and negatively regulates the transcription of the (trogen ixation) operon () in WLY78 by binding to two loci of the promoter according to nitrogen availability. However, the regulatory mechanisms of nitrogen metabolism mediated by GlnR in the genus remain unclear. In this study, we have revealed that glutamine synthetase (GS) and GlnR in WLY78 play a key role in the regulation of nitrogen metabolism. GS (encoded by within ) and GS1 (encoded by ) belong to distinct groups: GSI-α and GSI-β. Both GS and GS1 have the enzyme activity to convert NH and glutamate into glutamine, but only GS is involved in the repression by GlnR. GlnR represses transcription of under excess nitrogen, while it activates the expression of under nitrogen limitation. GlnR simultaneously activates and represses the expression of and in response to nitrogen availability. Also, GlnR regulates the expression of and . IMPORTANCE In this study, we have revealed that GlnR uses multiple mechanisms to regulate nitrogen metabolism. GlnR activates or represses or simultaneously activates and inhibits the transcription of nitrogen metabolism genes in response to nitrogen availability. The multiple regulation mechanisms employed by GlnR are very different from GlnR which represses nitrogen metabolism under excess nitrogen. Both GS encoded by within the operon and GS1 encoded by in WLY78 are involved in ammonium assimilation, but only GS is required for regulating GlnR activity. The work not only provides significant insight into understanding the interplay of GlnR and GS in nitrogen metabolism but also provides guidance for improving nitrogen fixation efficiency by modulating nitrogen metabolism.
PubMed: 37668407
DOI: 10.1128/aem.00139-23 -
Phytopathology Apr 2022is a beneficial bacterium for plant health. TP3 exhibits antagonistic activity toward and alleviates gray mold symptoms on the leaves of strawberry plants. Moreover,...
is a beneficial bacterium for plant health. TP3 exhibits antagonistic activity toward and alleviates gray mold symptoms on the leaves of strawberry plants. Moreover, suppression of gray mold on the flowers and fruits of strawberry plants in field trials, including vegetative cells and endospores, was demonstrated, indicating the potential of strain TP3 as a biological control agent. To examine the anti- compounds produced by TP3, we performed matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, and fusaricidin-corresponding mass spectra were detected. Moreover, fusaricidin-related signals appeared in imaging mass spectrometry of TP3 when confronted with . By using liquid chromatography mass spectrometry-based molecular networking approach, we identified several fusaricidins including a new variant of mass/charge ratio 917.5455 with serine in the first position of the hexapeptide. Via advanced mass spectrometry and network analysis, fusaricidin-type compounds produced by TP3 were efficiently disclosed and were presumed to play roles in the antagonism against gray mold pathogen .
Topics: Botrytis; Fragaria; Paenibacillus polymyxa; Peptide Fragments; Plant Diseases; Thymopoietins
PubMed: 34587815
DOI: 10.1094/PHYTO-04-21-0178-R -
International Journal of Molecular... Apr 2022With numerous industrial applications, has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression...
With numerous industrial applications, has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was "ACTTAGTTTAAGCAATAGACAAAGT", and this can be degenerated to "ACTTWGTTTAWSSNATAVACAAAGT" in spp., which differs from that in the spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter P. The eGFP fluorescence intensity assay indicated that both the modified and original P had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in spp. that can dynamically regulate its gene circuit strength through xylose.
Topics: Gene Expression; Operon; Paenibacillus; Paenibacillus polymyxa; Xylose
PubMed: 35563415
DOI: 10.3390/ijms23095024 -
Microbial Pathogenesis Jan 2023Bacterial consortium containing two bacterial strains such as Paenibacillus polymyxa HGA4C and Bacillus licheniformis HGA8B incorporated in the diet of Oreochromis...
Probiotic Paenibacillus polymyxa HGA4C and Bacillus licheniformis HGA8B combination improved growth performance, enzymatic profile, gene expression and disease resistance in Oreochromisniloticus.
Bacterial consortium containing two bacterial strains such as Paenibacillus polymyxa HGA4C and Bacillus licheniformis HGA8B incorporated in the diet of Oreochromis niloticus at a concentration of 1 × 10 CFU g (PB1) and 1 × 10 CFU g (PB2) revealed the probiotic potentials of the bacterial combination. The probiotic feed enhanced the growth performance, digestive enzymes, and antioxidant enzymes in the liver and intestine. Probiotic mediated growth enhancement was further substantiated by the up-regulation of genes such as GHR-1, GHR-2, IGF-1, and IGF-2 and the up-regulation of immune-related genes viz. TLR-2, IL-10, and TNF-α were also significantly modulated by probiotics supplementation. The intestinal MUC 2 gene expression revealed the mucosal remodification and the disease resistance of the fish challenged with Aeromonas hydrophila (MTCC-1739) was improved by the probiotic supplementation. Based on these results the new probiotic supplementation feed can be possibly marketed to help aquaculture farmers to alleviate many of the problems associated with fish farming.
Topics: Animals; Animal Feed; Bacillus licheniformis; Bacteria; Diet; Disease Resistance; Fish Diseases; Paenibacillus polymyxa; Probiotics; Transcriptome; Tilapia
PubMed: 36528324
DOI: 10.1016/j.micpath.2022.105951 -
Frontiers in Bioengineering and... 2024The demand for highly robust and metabolically versatile microbes is of utmost importance for replacing fossil-based processes with biotechnological ones. Such an...
The demand for highly robust and metabolically versatile microbes is of utmost importance for replacing fossil-based processes with biotechnological ones. Such an example is the implementation of DSM 365 as a novel platform organism for the production of value-added products such as 2,3-butanediol or exopolysaccharides. For this, a complete genome sequence is the first requirement towards further developing this host towards a microbial chassis. A genome sequencing project has just been reported for DSM 365 showing a size of 5,788,318 bp with a total of 47 contigs. Herein, we report the first complete genome sequence of DSM 365, which consists of 5,889,536 bp with 45 RNAs, 106 tRNAs, 5,370 coding sequences and an average GC content of 45.6%, resulting in a closed genome of 365. The additional nucleotide data revealed a novel NRPS synthetase that may contribute to the production of tridecaptin. Building on these findings, we initiated the top-down construction of a chassis variant of . In the first stage, single knock-out mutants of non-essential genomic regions were created and evaluated for their biological fitness. As a result, two out of 18 variants showed impaired growth. The remaining deletion mutants were combined in two genome-reduced variants which either lack the production of endogenous biosynthetic gene clusters (GR1) or non-essential genomic regions including the insertion sequence IS (GR2), with a decrease of the native genome of 3.0% and 0.6%, respectively. Both variants, GR1 and GR2, showed identical growth characteristics to the wild-type. Endpoint titers of 2,3-butanediol and EPS production were also unaffected, validating these genome-reduced strains as suitable for further genetic engineering.
PubMed: 38605990
DOI: 10.3389/fbioe.2024.1378873 -
Frontiers in Microbiology 2022Brewers' spent grains (BSG) are a by-product of the brewing industry that is mainly used as feedstock; otherwise, it has to be disposed according to regulations. Due to...
Brewers' spent grains (BSG) are a by-product of the brewing industry that is mainly used as feedstock; otherwise, it has to be disposed according to regulations. Due to the high content of glucose and xylose, after pretreatment and hydrolysis, it can be used as a main carbohydrate source for cultivation of microorganisms for production of biofuels or biochemicals like 2,3-butanediol or lactate. 2,3-Butanediol has applications in the pharmaceutical or chemical industry as a precursor for varnishes and paints or in the food industry as an aroma compound. So far, , , , and are being used and investigated in different bioprocesses aimed at the production of 2,3-butanediol. The main drawback is bacterial pathogenicity which complicates all production steps in laboratory, pilot, and industrial scales. In our study, a gram-positive GRAS bacterium DSM 742 was used for the production of 2,3-butanediol. Since this strain is very poorly described in literature, bacterium cultivation was performed in media with different glucose and/or xylose concentration ranges. The highest 2,3-butanediol concentration of 18.61 g l was achieved in medium with 70 g l of glucose during 40 h of fermentation. In contrast, during bacterium cultivation in xylose containing medium there was no significant 2,3-butanediol production. In the next stage, BSG hydrolysates were used for bacterial cultivation. DSM 742 cultivated in the liquid phase of pretreated BSG produced very low 2,3-butanediol and ethanol concentrations. Therefore, this BSG hydrolysate has to be detoxified in order to remove bacterial growth inhibitors. After detoxification, bacterium cultivation resulted in 30 g l of lactate, while production of 2,3-butanediol was negligible. The solid phase of pretreated BSG was also used for bacterium cultivation after its hydrolysis by commercial enzymes. In these cultivations, DSM 742 produced 9.8 g l of 2,3-butanediol and 3.93 g l of ethanol. On the basis of the obtained results, it can be concluded that different experimental setups give the possibility of directing the metabolism of DSM 742 toward the production of either 2,3-butanediol and ethanol or lactate.
PubMed: 35308344
DOI: 10.3389/fmicb.2022.812457