-
Frontiers in Immunology 2024The comorbidity rate of inflammatory bowel disease (IBD) and rheumatoid arthritis (RA) is high; nevertheless, the reasons behind this high rate remain unclear. Their...
BACKGROUND
The comorbidity rate of inflammatory bowel disease (IBD) and rheumatoid arthritis (RA) is high; nevertheless, the reasons behind this high rate remain unclear. Their similar genetic makeup probably contributes to this comorbidity.
METHODS
Based on data obtained from the genome-wide association study of IBD and RA, we first assessed an overall genetic association by performing the linkage disequilibrium score regression (LDSC) analysis. Further, a local correlation analysis was performed by estimating the heritability in summary statistics. Next, the causality between the two diseases was analyzed by two-sample Mendelian randomization (MR). A genetic overlap was analyzed by the conditional/conjoint false discovery rate (cond/conjFDR) method.LDSC with specific expression of gene analysis was performed to identify related tissues between the two diseases. Finally, GWAS multi-trait analysis (MTAG) was also carried out.
RESULTS
IBD and RA are correlated at the genomic level, both overall and locally. The MR results suggested that IBD induced RA. We identified 20 shared loci between IBD and RA on the basis of a conjFDR of <0.01. Additionally, we identified two tissues, namely spleen and small intestine terminal ileum, which were commonly associated with both IBD and RA.
CONCLUSION
Herein, we proved the presence of a polygenic overlap between the genetic makeup of IBD and RA and provided new insights into the genetic architecture and mechanisms underlying the high comorbidity between these two diseases.
Topics: Arthritis, Rheumatoid; Humans; Genome-Wide Association Study; Inflammatory Bowel Diseases; Genetic Predisposition to Disease; Linkage Disequilibrium; Polymorphism, Single Nucleotide; Mendelian Randomization Analysis; Comorbidity
PubMed: 38938570
DOI: 10.3389/fimmu.2024.1359857 -
Frontiers in Endocrinology 2024Insulin resistance (IR) and beta cell dysfunction are the major drivers of type 2 diabetes (T2D). Genome-Wide Association Studies (GWAS) on IR have been predominantly...
Insulin resistance (IR) and beta cell dysfunction are the major drivers of type 2 diabetes (T2D). Genome-Wide Association Studies (GWAS) on IR have been predominantly conducted in European populations, while Middle Eastern populations remain largely underrepresented. We conducted a GWAS on the indices of IR (HOMA2-IR) and beta cell function (HOMA2-%B) in 6,217 non-diabetic individuals from the Qatar Biobank (QBB; Discovery cohort; n = 2170, Replication cohort; n = 4047) with and without body mass index (BMI) adjustment. We also developed polygenic scores (PGS) for HOMA2-IR and compared their performance with a previously derived PGS for HOMA-IR (PGS003470). We replicated 11 loci that have been previously associated with HOMA-IR and 24 loci that have been associated with HOMA-%B, at nominal statistical significance. We also identified a novel locus associated with beta cell function near gene, tagged by rs61552983 ( = 4.38 × 10). Moreover, our best performing PGS (Q-PGS4; Adj R = 0.233 ± 0.014; = 1.55 x 10) performed better than PGS003470 (Adj R = 0.194 ± 0.014; = 5.45 x 10) in predicting HOMA2-IR in our dataset. This is the first GWAS on HOMA2 and the first GWAS conducted in the Middle East focusing on IR and beta cell function. Herein, we report a novel locus in that is implicated in beta cell dysfunction. Inclusion of under-represented populations in GWAS has potentials to provide important insights into the genetic architecture of IR and beta cell function.
Topics: Humans; Insulin Resistance; Genome-Wide Association Study; Female; Male; Middle Aged; Multifactorial Inheritance; Diabetes Mellitus, Type 2; Adult; Qatar; Polymorphism, Single Nucleotide; Insulin-Secreting Cells; Aged; Body Mass Index; Cohort Studies; Genetic Predisposition to Disease
PubMed: 38938516
DOI: 10.3389/fendo.2024.1384103 -
Journal of Preventive Medicine and... Jun 2024Comorbidities increase susceptibility to severe coronavirus disease 2019 (COVID-19) infections, but limited information has been published regarding HIV and COVID-19...
OBJECTIVES
Comorbidities increase susceptibility to severe coronavirus disease 2019 (COVID-19) infections, but limited information has been published regarding HIV and COVID-19 co-infections. This study explored the relationships among socioeconomic characteristics, sexual behaviors, and COVID-19 infection rates among Korean men who have sex with men (MSMs) who are also living with HIV.
METHODS
Data were collected through a web survey aimed at members of the largest gay portal site in Korea, supported by the National Research Foundation of Korea (n=1,005). The primary independent variables included COVID-19-related vaccinations and sexual behaviors. The dependent variable was the incidence of COVID-19 infection among respondents during the pandemic. For statistical analysis, hierarchical multiple logistic regression was performed, controlling for potential confounding variables.
RESULTS
Model I indicated that older MSM were less likely to contract COVID-19 (adjusted odds ratio [aOR], 0.975; 95% CI, 0.962-0.989). Model II demonstrated that HIV-positive MSM were nearly twice as likely to be infected with COVID-19 compared to their HIV-negative counterparts (aOR, 1.974; 95% CI, 1.144-3.408). Furthermore, even after accounting for COVID-19 vaccination status in model III, HIV-positive MSM continued to show a higher risk of infection (aOR, 1.934; 95% CI, 1.118-3.346).
CONCLUSIONS
The findings of this study indicate that HIV-positive MSM are at an increased risk of contracting COVID-19, even when their vaccination status is considered. Therefore, it is essential to prioritize the prevention of COVID-19 infections in HIV-positive individuals by administering appropriate antiretroviral therapy and ensuring adherence to public health guidelines.
PubMed: 38938044
DOI: 10.3961/jpmph.24.196 -
Molecular Therapy : the Journal of the... Jun 2024Alveolar bone loss in elderly populations is highly prevalent and increases the risk of tooth loss, gum disease susceptibility, and facial deformity. Unfortunately,...
Alveolar bone loss in elderly populations is highly prevalent and increases the risk of tooth loss, gum disease susceptibility, and facial deformity. Unfortunately, there are very limited treatment options available. Here, we developed a bone-targeted gene therapy that reverses alveolar bone loss in patients with osteoporosis by targeting the adaptor protein Schnurri-3 (SHN3). SHN3 is a promising therapeutic target for alveolar bone regeneration, because SHN3 expression is elevated in human and mouse mandible tissues with osteoporosis while deletion of SHN3 in mice greatly increases alveolar bone and tooth dentin mass. We used a bone-targeted recombinant adeno-associated virus (rAAV) carrying an artificial microRNA (miRNA) that silences SHN3 expression to restore alveolar bone loss in mouse models of both postmenopausal and senile osteoporosis by enhancing WNT signaling and osteoblast function. Additionally, rAAV-mediated silencing of SHN3 enhanced bone formation and collagen production of human skeletal organoids in xenograft mice. Finally, rAAV expression in the mandible was tightly controlled via liver- and heart-specific miRNA-mediated repression or via a vibration-inducible mechanism. Collectively, our results demonstrate that AAV-based bone anabolic gene therapy is a promising strategy to treat alveolar bone loss in osteoporosis.
PubMed: 38937970
DOI: 10.1016/j.ymthe.2024.06.036 -
Plant Disease Jun 2024During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas,...
During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas, USA and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Laurel, Maryland for pathogen identification and confirmatory testing. Ribo-depleted libraries for all four samples were prepared for high-throughput sequencing (HTS) analysis, using the RNA extracts of individual grapefruit samples. HTS yielded 13.6 to 22.8 million 75 bp paired-end raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (GenBank accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, a few Caulimoviridae and Retroviridae contigs were also identified in the libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. To know the association of chlorotic blotch symptoms with NeVM, 12 symptomatic and 4 non-symptomatic grapefruit samples were collected for testing (Supplementary Figure 1). A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´)/NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a detection assay. The results of the 671 bp amplicon sequencing showed that 13 (12+1) of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 87.63-92.25% nt identities with the nectarine isolates of NeVM (KT273411-13) and 78% with the Canadian prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived 2019 (TX4) and 2023 leaf tissue samples (LF1 and LF2) from La Feria, TX were selected for genetic analysis. The primer pair Marafi Gen-1F/NeVM-1R targeting the helicase domain of NeVM, successfully amplified the expected 671 bp product. The amplicon sequence of isolate TX4 shared 97.76% and 89.87% nt identities with isolates LF1 and LF2, respectively, while LF1 shared 90.76% nt identity with LF2. Sequence variation was observed for a 1906 bp overlapping amplicon obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´)/Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG3´), spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of TX4 shared 94 and 95% nt identities with LF2 and LF1, respectively, but only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91.08 to 92.29% nt identity with American prunus isolates (KT273411-13) and 75% nt identity with Canadian isolate (MZ291915). Three sequences of 671 bp and 1906 bp amplicons were deposited in GenBank under accession numbers PP767656-61. From the regulatory point of view, NeVM fails to satisfy the criteria to be considered as potential quarantine pests for the European Union because of the absence of information on its biology, distribution, and economic impact (Bragard et al., 2019). However, this report expands the natural host range of NeVM to include grapefruit. From an epidemiological standpoint, more data on host range, varietal susceptibility, and genetic variability among citrus and prunus isolates are needed to conclude the association of NeVM infection with symptoms development.
PubMed: 38937932
DOI: 10.1094/PDIS-05-24-1024-PDN -
Skin Research and Technology : Official... Jul 2024Patients with myotonic muscular dystrophy (MMD) were observed to have numerous basal cell carcinoma (BCC) and abnormal dysplastic nevi (DN) on non-sun exposed skin.... (Review)
Review
OBJECTIVE
Patients with myotonic muscular dystrophy (MMD) were observed to have numerous basal cell carcinoma (BCC) and abnormal dysplastic nevi (DN) on non-sun exposed skin. Simultaneously a large study published in the Journal of American Medical Association (JAMA) illustrated that patients with MMD have "overall" an increased risk for cancer development. Based on these findings, this author in 2010 postulated that dysregulation of RNA binding proteins (RBP), responsible for clinical manifestations of MMD, is also responsible for the development of BCC and melanoma.
METHODS
To report new research elucidating the etiology of melanoma, BCC, MMD-induced cancers, and potentially other environmentally induced malignancies.
RESULTS
Dysregulation of RBP induces aberrant mRNA splicing; recent data indicates that abnormal mRNA splicing not just plays a key role in the pathogenesis of melanoma but is a hallmark of essentially all human malignancies.
CONCLUSION
The author's hypothesis is that ultraviolet (UV) radiation induces DNA damage in intronic regions of a variety of genes. Furthermore, these UV-induced abnormal DNA dimers, repeats and mutations interfere with normal mRNA splicing thus producing abnormal proteins. These abnormal proteins in turn activate oncogenic pathways such as hedgehog, MAP kinase, and WNT.
Topics: Humans; Skin Neoplasms; Melanoma; Carcinoma, Basal Cell; Genetic Predisposition to Disease; Genetic Testing; Myotonic Dystrophy; Ultraviolet Rays
PubMed: 38937899
DOI: 10.1111/srt.13832 -
Skin Research and Technology : Official... Jul 2024Prior research has explored the relationship between inflammatory skin disorders and breast cancer (BC), yet the causality of this association remains uncertain.
INTRODUCTION
Prior research has explored the relationship between inflammatory skin disorders and breast cancer (BC), yet the causality of this association remains uncertain.
METHODS
Utilizing a bidirectional two-sample Mendelian randomization (MR) approach, this study aimed to elucidate the causal dynamics between various inflammatory skin conditions-namely acne, atopic dermatitis, psoriasis vulgaris, urticaria, and rosacea-and BC. Genetic variants implicated in these disorders were sourced from comprehensive genome-wide association studies representative of European ancestry. In the forward MR, BC was posited as the exposure, while the reverse MR treated each inflammatory skin disease as the exposure. A suite of analytical methodologies, including random effects inverse variance weighted (IVW), weighted median (WME), and MR-Egger, were employed to probe the causative links between inflammatory skin diseases and BC. Sensitivity analyses, alongside evaluations for heterogeneity and pleiotropy, were conducted to substantiate the findings.
RESULTS
The MR analysis revealed an increased risk of acne associated with BC (IVW: OR = 1.063, 95% CI = 1.011-1.117, p = 0.016), while noting a decreased risk of atopic dermatitis (AD) in BC patients (IVW: OR = 0.941, 95% CI = 0.886-0.999, p = 0.047). No significant associations were observed between BC and psoriasis vulgaris, urticaria, or rosacea. Conversely, reverse MR analyses detected no effect of BC on the incidence of inflammatory skin diseases. The absence of pleiotropy and the consistency of these outcomes strengthen the study's conclusions.
CONCLUSION
Findings indicate an elevated incidence of acne and a reduced incidence of AD in individuals with BC within the European population.
Topics: Humans; Mendelian Randomization Analysis; Female; Breast Neoplasms; Rosacea; Psoriasis; Dermatitis, Atopic; Genome-Wide Association Study; Acne Vulgaris; Urticaria; Genetic Predisposition to Disease
PubMed: 38937884
DOI: 10.1111/srt.13782 -
BMC Psychiatry Jun 2024Observational studies have indicated a correlation between immunological inflammation and the risk of autism spectrum disorder (ASD). However, the causal relationship... (Meta-Analysis)
Meta-Analysis
BACKGROUND
Observational studies have indicated a correlation between immunological inflammation and the risk of autism spectrum disorder (ASD). However, the causal relationship between immunological inflammation and ASD remains uncertain.
METHODS
Immunity-wide data sources were retrieved from the GWAS catalog. Genetic summary data on ASD were retrieved from two independent GWAS. We performed two independent bi-directional, two-sample Mendelian randomization (MR) analyses and a meta-analysis based on the two independent MR estimates to assess the causal relationship between ASD and immune cell signatures.
RESULTS
We have discovered 26 potential correlations between genetic predisposition in the immunophenotypes and ASD. The meta-analysis of the two inverse variance weighted (IVW)-produced estimates provided further evidence supporting the potential causal relationship between immunophenotypes and ASD. Based on the findings of the reverse MR analysis, it was determined that there are two potential negative causal relationships between ASD and immunophenotypes. However, the meta-analysis of the two IVW-derived MR estimates indicated that immunophenotypes were not significantly influenced by ASD (OR = 0.87, 95% CI = 0.73 -1.03, P = 0.09; OR = 0.91, 95% CI = 0.81-1.01, P = 0.08).
CONCLUSIONS
This study expanded immune cell subtypes that were potentially causally associated with ASD risk as well as identified ASD-specific immune cell subtypes. The discovery has the potential to lead to earlier detection and more effective treatment techniques.
Topics: Humans; Mendelian Randomization Analysis; Autism Spectrum Disorder; Genetic Predisposition to Disease; Genome-Wide Association Study; Immunophenotyping; Inflammation
PubMed: 38937836
DOI: 10.1186/s12888-024-05927-5 -
Immunity & Ageing : I & A Jun 2024Although it is well known that the older people have been the most susceptible to COVID-19, there are conflicting data on the susceptibility of centenarians. Two...
BACKGROUND
Although it is well known that the older people have been the most susceptible to COVID-19, there are conflicting data on the susceptibility of centenarians. Two epidemiological study have shown that older centenarians (> 101 years old at the time of the 2020 pandemic peak) are more resilient than the remaining centenarians, suggesting that this resilience might be linked to the 1918 Spanish Flu pandemic. To gain insight into this matter, specifically whether the resilience of older centenarians to SARS-CoV-2 infection is linked to the Spanish Flu they had been affected by, we conducted a retrospective serological study. This study examined serum samples from 33 centenarians, encompassing semi- (aged > 104 < 110 years, N = 7) and supercentenarians (aged > 109 years, N = 4), born between 1905 and 1922, against both SARS-CoV-2 and 1918 H1N1 pseudotype virus.
RESULTS
Anamnestic and laboratory data suggest that SARS-CoV-2 infection occurred in 8 centenarians. The infection appeared to have been asymptomatic or mild, and hospitalization was not required, despite 3 out of 8 being between 109 and 110 years old. The levels of anti-spike antibodies in centenarians infected and/or vaccinated were higher, although not significantly, than those produced by a random sample of seventy-year-old individuals used as controls. All centenarians had antibody levels against the 1918 H1N1 virus significantly higher (almost 50 times) than those observed in the quoted group of seventy-year-old subjects, confirming the key role in maintaining immunological memory from a priming that occurred over 100 years ago. Centenarians whose blood was collected prior to the pandemic outbreak demonstrated neutralising antibodies against the 1918 H1N1 virus, but all these subjects tested negative for SARS-CoV-2.
CONCLUSION
This retrospective study shows that older centenarians are quite resilient to COVID-19, as they are capable of producing good levels of neutralising antibodies and experiencing mild or asymptomatic disease. This could be attributed to the 1918 Spanish flu pandemic through mechanisms other than the presence of cross-reactive antibodies between the 1918 H1N1 virus and SARS-CoV-2. Another possibility is that the association is purely temporal, solely correlated with the advanced age of resilient centenarians compared to those born after 1918, since older centenarians are known to have better control of immune-inflammatory responses.
PubMed: 38937774
DOI: 10.1186/s12979-024-00450-3 -
Lipids in Health and Disease Jun 2024Digestive system cancers represent a significant global health challenge and are attributed to a combination of demographic and lifestyle changes. Lipidomics has emerged...
BACKGROUND
Digestive system cancers represent a significant global health challenge and are attributed to a combination of demographic and lifestyle changes. Lipidomics has emerged as a pivotal area in cancer research, suggesting that alterations in lipid metabolism are closely linked to cancer development. However, the causal relationship between specific lipid profiles and digestive system cancer risk remains unclear.
METHODS
Using a two-sample Mendelian randomization (MR) approach, we elucidated the causal relationships between lipidomic profiles and the risk of five types of digestive system cancer: stomach, liver, esophageal, pancreatic, and colorectal cancers. The aim of this study was to investigate the effect impact of developing lipid profiles on the risk of digestive system cancers utilizing data from public databases such as the GWAS Catalog and the UK Biobank. The inverse‒variance weighted (IVW) method and other strict MR methods were used to evaluate the potential causal links. In addition, we performed sensitivity analyses and reverse MR analyses to ensure the robustness of the results.
RESULTS
Significant causal relationships were identified between certain lipidomic traits and the risk of developing digestive system cancers. Elevated sphingomyelin (d40:1) levels were associated with a reduced risk of developing gastric cancer (odds ratio (OR) = 0.68, P < 0.001), while elevated levels of phosphatidylcholine (16:1_20:4) increased the risk of developing esophageal cancer (OR = 1.31, P = 0.02). Conversely, phosphatidylcholine (18:2_0:0) had a protective effect against colorectal cancer (OR = 0.86, P = 0.036). The bidirectional analysis did not suggest reverse causality between cancer risk and lipid levels. Strict MR methods demonstrated the robustness of the above causal relationships.
CONCLUSION
Our findings underscore the significant causal relationships between specific lipidomic traits and the risk of developing various digestive system cancers, highlighting the potential of lipid profiles in informing cancer prevention and treatment strategies. These results reinforce the value of MR in unraveling complex lipid-cancer interactions, offering new avenues for research and clinical application.
Topics: Humans; Mendelian Randomization Analysis; Digestive System Neoplasms; Genome-Wide Association Study; Lipid Metabolism; Lipids; Risk Factors; Lipidomics; Genetic Predisposition to Disease; Sphingomyelins; Esophageal Neoplasms
PubMed: 38937739
DOI: 10.1186/s12944-024-02191-0