-
International Journal of Molecular... Jan 2024Albinism is characterized by a variable degree of hypopigmentation affecting the skin and the hair, and causing ophthalmologic abnormalities. Its oculocutaneous, ocular...
Albinism is characterized by a variable degree of hypopigmentation affecting the skin and the hair, and causing ophthalmologic abnormalities. Its oculocutaneous, ocular and syndromic forms follow an autosomal or X-linked recessive mode of inheritance, and 22 disease-causing genes are implicated in their development. Our aim was to clarify the genetic background of a Hungarian albinism cohort. Using a 22-gene albinism panel, the genetic background of 11 of the 17 Hungarian patients was elucidated. In patients with unidentified genetic backgrounds ( = 6), whole exome sequencing was performed. Our investigations revealed a novel, previously unreported rare variant (N687S) of the two-pore channel two gene (). The N687S variant of the encoded TPC2 protein is carried by a 15-year-old Hungarian male albinism patient and his clinically unaffected mother. Our segregational analysis and in vitro functional experiments suggest that the detected novel rare variant alone is not a disease-causing variant in albinism. Deep genetic analyses of the family revealed that the patient also carries a phenotype-modifying R305W variant of the OCA2 protein, and he is the only family member harboring this genotype. Our results raise the possibility that this digenic combination might contribute to the observed differences between the patient and the mother, and found the genetic background of the disease in his case.
Topics: Humans; Male; Adolescent; Hungary; Mutation; Membrane Transport Proteins; Albinism; Genetic Background
PubMed: 38279271
DOI: 10.3390/ijms25021271 -
Molecular Vision 2023Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes....
PURPOSE
Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation.
METHODS
A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of . Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations.
RESULTS
Genetic analysis identified 11 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a mutation were found to present a typical or atypical phenotype of OA1. All patients with mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia.
CONCLUSIONS
We discovered seven novel mutations and four previously reported mutations of in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.
Topics: Humans; Albinism, Ocular; Eye Proteins; Genetic Diseases, X-Linked; Iris; Membrane Glycoproteins; Mutation; Nystagmus, Congenital; Pedigree
PubMed: 38222445
DOI: No ID Found -
Experimental Eye Research Feb 2024Oculocutaneous albinism (OCA) is a rare inherited disorder characterized by a partial or complete reduction of melanin biosynthesis that leads to hypopigmentation in the...
Oculocutaneous albinism (OCA) is a rare inherited disorder characterized by a partial or complete reduction of melanin biosynthesis that leads to hypopigmentation in the skin, hair and eyes. The OCA1 subtype is caused by mutations in TYR. The purpose of this study was to investigate the genetic and clinical ophthalmic characteristics of TYR mutations in patients with OCA. Herein, 51 probands with a clinical diagnosis of OCA were enrolled. Whole-exome sequencing and comprehensive ophthalmic examinations were performed. Overall, TYR mutations were detected in 37.3% (19/51) in the patients with OCA. Fifteen patients had compound heterozygous variants, and four cases had homozygous variants. Eleven different pathogenic variants in TYR were detected in these 19 patients, with missense, insertion, delins and nonsense in 71.1% (27/38), 15.8% (6/38), 2.6% (1/38), and 10.5% (4/38), respectively. Clinical examinations revealed that 84.2% (16/19) of patients were OCA1A, and 15.8% (3/19) were OCA1B. Most TYR probands (52.6%, 10/19) had moderate vision impairment, 15.8% (3/19) had severe visual impairment, 10.5% (2/19) exhibited blindness, only 5.3% (1/19) had mild visual impairment and 15.8% (3/19) were not available. Photophobia and nystagmus were found in 100% (19/19) of the patients. In addition, grade 4 foveal hypoplasia was detected in 100% (12/12) of the patients. In conclusion: The TYR patients exhibited severe ocular phenotypes: the majority (93.8%, 15/16) of them had a moderate vision impairment or worse, and 100% (12/12) had severe grade 4 foveal hypoplasia. These novel findings could provide insight into the understanding of OCA.
Topics: Humans; Albinism, Oculocutaneous; China; Monophenol Monooxygenase; Mutation; Retina; Vision Disorders
PubMed: 38145795
DOI: 10.1016/j.exer.2023.109761 -
Children (Basel, Switzerland) Dec 2023(1) Background: The aim of the study was to describe refractive development from early childhood to adulthood in Danish patients with albinism and to evaluate the effect...
(1) Background: The aim of the study was to describe refractive development from early childhood to adulthood in Danish patients with albinism and to evaluate the effect of foveal developmental stage on refractive development; (2) Methods: Patients with a clinical diagnosis of ocular or oculocutaneous albinism were invited for a refractive evaluation and comprehensive phenotyping including macular optical coherence tomography (OCT) scans. Foveal hypoplasia was graded based on OCT from 0 (normal) to 4 (absence of any signs of foveal specialization). Medical files were reviewed for historical refractive values in individual patients; (3) Results: Hyperopia (spherical equivalent refraction (SEQ) of ≥+1 Diopter (D)) was common in both children (81.3%) and adults (67.1%). The lower prevalence of hyperopia in adults was predominantly explained by increasing astigmatism with age. Emmetropization (>2D change from before 3 years to adolescence) was seen in 22.2%. There was no influence on foveal hypoplasia grade on the degree of refractive errors throughout life; (4) Conclusions: We found that emmetropization was uncommon in Danish patients with albinism and that the degree of foveal developmental stage did not influence emmetropization or the distribution of refractive errors. High degrees of hyperopia and astigmatism were common. These results indicate that fear of impeding emmetropization should not refrain the clinician from providing adequate correction for refractive errors in young children with albinism.
PubMed: 38136112
DOI: 10.3390/children10121910 -
International Journal of Dermatology Mar 2024Exposure to solar ultraviolet radiation (UVR) is associated with several cutaneous adverse effects. However, to the best of our knowledge, in South Africa there are no... (Review)
Review
Exposure to solar ultraviolet radiation (UVR) is associated with several cutaneous adverse effects. However, to the best of our knowledge, in South Africa there are no formal guidelines on sun protection. A group of South African dermatologists and researchers convened over the course of 1 year to deliberate on integrated advice for sun protection among the multi-ethnic South African population. For people with light skin and those with genetic skin disorders (e.g., oculocutaneous albinism), sun protection was identified as critical to prevent sunburn, skin cancer, and photoaging. The evidence is less clear for people with medium and darker skin types, especially the latter, in whom melanin may confer a degree of protection against some parts of the solar spectrum. Recent studies have demonstrated that visible light can cause pigmentary changes in individuals with darker skin types in particular. Sun protection for people of all skin colors is beneficial to protect against photoaging and ocular damage. Herein sun protection advice is suggested for South Africans of all skin colors to reduce morbidity and mortality from sun exposure, particularly relating to skin cancer. Several knowledge gaps are identified as future research priorities.
Topics: Humans; Ultraviolet Rays; South Africa; Sunlight; Sunburn; Skin Neoplasms; Sunscreening Agents
PubMed: 38124402
DOI: 10.1111/ijd.16980 -
Ophthalmic Genetics Dec 2023We report a case of Hermansky-Pudlak Syndrome type 7 (HPS-7) caused by a homozygous variant in the dystrobrevin-binding protein 1 gene () and highlight the genetic...
PURPOSE
We report a case of Hermansky-Pudlak Syndrome type 7 (HPS-7) caused by a homozygous variant in the dystrobrevin-binding protein 1 gene () and highlight the genetic challenges associated with this rare disorder.
METHODS
Case report. Literature review was performed by searching PubMed on May 2023, without language or date restriction, using the following terms: Hermansky-Pudlak syndrome, Hermansky-Pudlak syndrome type 7, and dystrobrevin-binding protein 1 gene.
RESULTS
We report a case of a 69-year-old Portuguese female who presented for ophthalmic evaluation with long-standing severe visual impairment, pronounced photophobia, right-eye esotropia, and bilateral pendular nystagmus. Anterior segment examination revealed iris transillumination defects, while the ocular fundus showed hypopigmentation and the absence of the foveal reflex. The patient had a history of oculocutaneous albinism (OCA) and recurrent epistaxis. Her family history was positive for first-degree consanguineous parents and a deceased sister at young age who also exhibited OCA and recurrent epistaxis. Genetic testing identified a homozygous pathogenic nonsense variant in the , c.307C>T p.(Gln103*). The patient's clinical features and genetic testing support the diagnosis of HPS-7. The identified variant has been previously reported in the literature, in adult patients of Portuguese descent.
CONCLUSION
This work highlights the genetic complexity of HPS-7 and emphasizes the importance of genetic testing in the diagnosis of this rare disorder. The identification of a rare pathogenic variant expands our understanding of HPS-7 genetics and suggests a possible founder effect in the Portuguese population.
PubMed: 38097925
DOI: 10.1080/13816810.2023.2291670 -
Ophthalmic Research 2024Hermansky-Pudlak syndrome (HPS) is a rare autosomal-recessive disease characterized by ocular albinism (OA) or oculocutaneous albinism (OCA), platelet dysfunction, and...
INTRODUCTION
Hermansky-Pudlak syndrome (HPS) is a rare autosomal-recessive disease characterized by ocular albinism (OA) or oculocutaneous albinism (OCA), platelet dysfunction, and other symptoms. This study aimed to analyze the molecular defect in two Chinese families with suspected OA, as well as to investigate the profile of HPS6 variants and their genotype-phenotype correlations.
METHODS
Seven members from two families were recruited and underwent clinical ophthalmologic examinations. The genomic DNA was extracted from peripheral blood leukocytes. Whole-exome sequencing was performed on the proband of family JX. The single coding exon of HPS6 was directly Sanger sequenced based on PCR amplification in all available family members. An additional 46 probands from families or sporadic cases with the pathogenic variants of HPS6 reported in the literature were reviewed.
RESULTS
We identified two different compound heterozygous truncating variants of HPS6 in probands with suspected OA from two independent families. The proband of family JX had c.1674dup and c.503-504del variants, and the other proband from family CZ had a nonsense variant of c.1114C>T and a frameshift variant of c.1556del. Among them, c.1674dup and c.1556del variants in HPS6 have not been reported previously. Therefore, our patients were diagnosed as HPS6 disease by molecular diagnostics. In the retrospective cohort of HPS6 patients, we delineated the profile of HPS6 variants and revealed a significant overlap between CpG islands and the variants of HPS6, suggesting a potential link between DNA methylation and HPS6 variants. We also observed a spatial aggregation of the variants in 3D structure of HPS6 protein, implying the possible functional significance of these structural regions. In addition, we did not find any significant genotype-phenotype correlation of HPS6, and neither did we observe a correlation between the truncation length of the HPS6 protein and the phenotype of HPS6 disease.
CONCLUSION
Our research expands the spectrum of HPS6 variants, providing a comprehensive delineation of their profile and systematically investigating genotype-phenotype correlations in HPS6. These findings could offer potentially valuable clues for investigating the molecular mechanism underlying HPS6 pathogenesis, as well as aiding the clinical diagnosis of HPS6 patients and improving disease prognosis.
Topics: Humans; Albinism, Ocular; Retrospective Studies; Hermanski-Pudlak Syndrome; Phenotype; Proteins; Mutation; Pedigree; Intracellular Signaling Peptides and Proteins
PubMed: 38091959
DOI: 10.1159/000535788 -
Experimental Eye Research Jan 2024Heterozygous mutation of PAX6 in humans leads to congenital aniridia (OMIM 106210) which is typified by congenital iris and foveal defects, and later onset glaucoma,...
Heterozygous mutation of PAX6 in humans leads to congenital aniridia (OMIM 106210) which is typified by congenital iris and foveal defects, and later onset glaucoma, aniridic keratopathy, and cataract. Mice heterozygous for Pax6 mutations phenocopy many aspects of aniridia including the iris defects, keratopathy and cataract, although Pax6 mutant mice have small lenses, a phenotype which is not typically reported in human aniridia, perhaps due to difficulties in measuring lens diameter during typical ophthalmic examinations as the lens periphery is shielded by the iris. In order to overcome this, records of patients diagnosed with congenital aniridia between April 2015 and May 2021 at the Necker-Enfants Malades Hospital, and genetically confirmed with a disease-causing PAX6 variant, were retrospectively reviewed for those with normal axial length whose iris defects allowed visualization of the lens margins and corneal diameter to allow calculation of a lens/corneal diameter ratio. This value was compared with values obtained from a cohort of patients with Sjödell grade IV oculocutaneous albinism type 1 (OCA1; OMIM 203100) which allowed visualization of the lens periphery via iris transillumination. This analysis revealed that patients with congenital aniridia had a significantly lower lens/corneal ratio when compared to those with albinism, suggesting that humans haploinsufficient for PAX6, like mice, rats, frogs, and zebrafish, exhibit reductions in lens size.
Topics: Humans; Mice; Rats; Animals; PAX6 Transcription Factor; Paired Box Transcription Factors; Retrospective Studies; Zebrafish; Aniridia; Mutation; Corneal Diseases; Cataract; Homeodomain Proteins; Eye Proteins
PubMed: 38056551
DOI: 10.1016/j.exer.2023.109746 -
European Journal of Human Genetics :... Nov 2023Oculocutaneous albinism is an inherited disorder of melanin biosynthesis, characterized by absent or reduced pigmentation of the skin, hair, and eyes. Molecular...
Oculocutaneous albinism is an inherited disorder of melanin biosynthesis, characterized by absent or reduced pigmentation of the skin, hair, and eyes. Molecular alterations of genes that cause non-syndromic albinism in Asian Indians are poorly characterized. This information would be useful for developing therapies for this disorder. We analyzed 164 persons with non-syndromic albinism, belonging to unrelated families from all parts of India, for molecular changes in the causative genes. Subjects with white hair, white skin, and red iris had their tyrosinase gene sequenced and were also tested by MLPA for deletions/duplications. Subjects with negative results or with darker skin, golden/brown or darker hair had sequencing of TYR, P, TYRP1, SLC45A2 and GPR143 genes. Pathogenic variants in TYR (OCA1) were observed in 139 (84.7%) patients, in the P gene (OCA2) in 20 (12.2%), in TYRP1 (OCA3) in two (1.2%), in SLC45A2 (OCA 4) in one (0.61%), and in GPR143 (X-linked ocular albinism) in two (1.2%) patients. Of 278 alleles with variants in TYR, 179 (64.3%) alleles had (p.R278*) alteration, suggesting the possibility of therapy with a stop codon readthrough molecule. We report 20 patients with 13 disease associated variants in the P gene and 18 novel pathogenic variants in TYR, P, TYRP1, SLC45A2 and GPR143 genes. The data are compared with those reported from India, Pakistan and rest of the world. The therapeutic options in albinism are briefly described, opening this field for future therapies.
PubMed: 38030918
DOI: 10.1038/s41431-023-01496-5 -
Zhonghua Yi Xue Yi Chuan Xue Za Zhi =... Nov 2023To explore the clinical and genetic characteristics of a patient with Hermansky-Pudlak syndrome type 5 (HPS-5). (Review)
Review
OBJECTIVE
To explore the clinical and genetic characteristics of a patient with Hermansky-Pudlak syndrome type 5 (HPS-5).
METHODS
A child with HPS-5 who had attended the Children's Hospital Affiliated to Shandong University on October 3, 2019 was selected as the study subject. Clinical data of the child were collected. Genetic variant was analyzed through high-throughput sequencing. A literature review was also carried out.
RESULTS
The child, a 1-year-and-5-month-old girl, had nystagmus since childhood, lost of retinal pigmentation by fundus examination and easy bruising. High-throughput sequencing revealed that she has harbored compound heterozygous variants of the HPS5 gene, namely c.1562_1563delAA (p.F521Sfs*27) and c.1404C>A (p.C468X), which were inherited from his father and mother, respectively. Based on the guidelines from the American College for Medical Genetics and Genomics (ACMG), both variants were predicted to be pathogenic (PVS+PM2_Supporting+PM3+PP4). Among 18 previously reported HPS-5 patients, all had had eye problems, and most of them had tendency for bleeding. Eight cases had carried compound heterozygous variants of the HPS5 gene, 8 carried homozygous variants, 2 carried double homozygous variants, and most of them were null mutations.
CONCLUSION
The c.1562_1563delAA(p.F521Sfs*27) and c.1404C>A (p.C468X) compound heterozygous variants of the HPS5 gene probably underlay the HPS-5 in this child. High-throughput sequencing has provided an important tool for the diagnosis. HSP-5 patients usually have typical ocular albinism and/or oculocutaneous albinism and tendency of bleeding, which are commonly caused by compound heterozygous and homozygous variants of the HPS5 gene, though serious complications have been rare.
Topics: Female; Humans; Infant; Hermanski-Pudlak Syndrome; High-Throughput Nucleotide Sequencing; Mutation
PubMed: 37906148
DOI: 10.3760/cma.j.cn511374-20211101-00868