-
Journal of Extracellular Biology Jan 2024Extracellular vesicles (EVs) are membranous structures released by cells into the extracellular space and are thought to be involved in cell-to-cell communication. While...
Extracellular vesicles (EVs) are membranous structures released by cells into the extracellular space and are thought to be involved in cell-to-cell communication. While EVs and their cargo are promising biomarker candidates, sorting mechanisms of proteins to EVs remain unclear. In this study, we ask if it is possible to determine EV association based on the protein sequence. Additionally, we ask what the most important determinants are for EV association. We answer these questions with explainable AI models, using human proteome data from EV databases to train and validate the model. It is essential to correct the datasets for contaminants introduced by coarse EV isolation workflows and for experimental bias caused by mass spectrometry. In this study, we show that it is indeed possible to predict EV association from the protein sequence: a simple sequence-based model for predicting EV proteins achieved an area under the curve of 0.77 ± 0.01, which increased further to 0.84 ± 0.00 when incorporating curated post-translational modification (PTM) annotations. Feature analysis shows that EV-associated proteins are stable, polar, and structured with low isoelectric point compared to non-EV proteins. PTM annotations emerged as the most important features for correct classification; specifically, palmitoylation is one of the most prevalent EV sorting mechanisms for unique proteins. Palmitoylation and nitrosylation sites are especially prevalent in EV proteins that are determined by very strict isolation protocols, indicating they could potentially serve as quality control criteria for future studies. This computational study offers an effective sequence-based predictor of EV associated proteins with extensive characterisation of the human EV proteome that can explain for individual proteins which factors contribute to their EV association.
PubMed: 38938677
DOI: 10.1002/jex2.120 -
PeerJ 2024Patients with lung adenocarcinoma (LUAD) often develop a poor prognosis. Currently, researches on prognostic and immunotherapeutic capacity of aneuploidy-related genes...
Integrated bulk and single-cell RNA sequencing identifies an aneuploidy-based gene signature to predict sensitivity of lung adenocarcinoma to traditional chemotherapy drugs and patients' prognosis.
BACKGROUND
Patients with lung adenocarcinoma (LUAD) often develop a poor prognosis. Currently, researches on prognostic and immunotherapeutic capacity of aneuploidy-related genes in LUAD are limited.
METHODS
Genes related to aneuploidy were screened based on bulk RNA sequencing data from public databases using Spearman method. Next, univariate Cox and Lasso regression analyses were performed to establish an aneuploidy-related riskscore (ARS) model. Results derived from bioinformatics analysis were further validated using cellular experiments. In addition, typical LUAD cells were identified by subtype clustering, followed by SCENIC and intercellular communication analyses. Finally, ESTIMATE, ssGSEA and CIBERSORT algorithms were employed to analyze the potential relationship between ARS and tumor immune environment.
RESULTS
A five-gene ARS signature was developed. These genes were abnormally high-expressed in LUAD cell lines, and in particular the high expression of CKS1B promoted the proliferative, migratory and invasive phenotypes of LUAD cell lines. Low ARS group had longer overall survival time, higher degrees of inflammatory infiltration, and could benefit more from receiving immunotherapy. Patients in low ASR group responded more actively to traditional chemotherapy drugs (Erlotinib and Roscovitine). The scRNA-seq analysis annotated 17 cell subpopulations into seven cell clusters. Core transcription factors (TFs) such as CREB3L1 and CEBPD were enriched in high ARS cell group, while TFs such as BCLAF1 and UQCRB were enriched in low ARS cell group. CellChat analysis revealed that high ARS cell groups communicated with immune cells SPP1 (ITGA4-ITGB1) and MK (MDK-NCl) signaling pathways.
CONCLUSION
In this research, integrative analysis based on the ARS model provided a potential direction for improving the diagnosis and treatment of LUAD.
Topics: Humans; Adenocarcinoma of Lung; Lung Neoplasms; Aneuploidy; Prognosis; Single-Cell Analysis; CDC2-CDC28 Kinases; Cell Line, Tumor; Sequence Analysis, RNA; Antineoplastic Agents; Gene Expression Regulation, Neoplastic; Computational Biology; Male
PubMed: 38938612
DOI: 10.7717/peerj.17545 -
PeerJ 2024White-rot fungi and bacteria communities are unique ecosystems with different types of symbiotic interactions occurring during wood decomposition, such as cooperation,...
Sequence and structure analyses of lytic polysaccharide monooxygenases mined from metagenomic DNA of humus samples around white-rot fungi in Cuc Phuong tropical forest, Vietnam.
BACKGROUND
White-rot fungi and bacteria communities are unique ecosystems with different types of symbiotic interactions occurring during wood decomposition, such as cooperation, mutualism, nutritional competition, and antagonism. The role of chitin-active lytic polysaccharide monooxygenases (LPMOs) in these symbiotic interactions is the subject of this study.
METHOD
In this study, bioinformatics tools were used to analyze the sequence and structure of putative LPMOs mined by hidden Markov model (HMM) profiles from the bacterial metagenomic DNA database of collected humus samples around white-rot fungi in Cuc Phuong primary forest, Vietnam. Two genes encoding putative LPMOs were expressed in and purified for enzyme activity assay.
RESULT
Thirty-one full-length proteins annotated as putative LPMOs according to HMM profiles were confirmed by amino acid sequence comparison. The comparison results showed that although the amino acid sequences of the proteins were very different, they shared nine conserved amino acids, including two histidine and one phenylalanine that characterize the H1-Hx-Yz motif of the active site of bacterial LPMOs. Structural analysis of these proteins revealed that they are multidomain proteins with different functions. Prediction of the catalytic domain 3-D structure of these putative LPMOs using Alphafold2 showed that their spatial structures were very similar in shape, although their protein sequences were very different. The results of testing the activity of proteins GL0247266 and GL0183513 show that they are chitin-active LPMOs. Prediction of the 3-D structures of these two LPMOs using Alphafold2 showed that GL0247266 had five functional domains, while GL0183513 had four functional domains, two of which that were similar to the GbpA_2 and GbpA_3 domains of protein GbpA of bacteria. The GbpA_2 - GbpA_3 complex was also detected in 11 other proteins. Based on the structural characteristics of functional domains, it is possible to hypothesize the role of chitin-active GbpA-like LPMOs in the relationship between fungal and bacterial communities coexisting on decomposing trees in primary forests.
Topics: Vietnam; Mixed Function Oxygenases; Forests; Chitin; Metagenomics; Metagenome; Amino Acid Sequence
PubMed: 38938609
DOI: 10.7717/peerj.17553 -
Molecular Genetics & Genomic Medicine Jun 2024Spastic paraplegia 11 (SPG11) is the most prevalent form of autosomal recessive hereditary spastic paraplegia, resulting from biallelic pathogenic variants in the SPG11...
BACKGROUND
Spastic paraplegia 11 (SPG11) is the most prevalent form of autosomal recessive hereditary spastic paraplegia, resulting from biallelic pathogenic variants in the SPG11 gene (MIM *610844).
METHODS
The proband is a 36-year-old female referred for genetic evaluation due to cognitive dysfunction, gait impairment, and corpus callosum atrophy (brain MRI was normal at 25-years-old). Diagnostic approaches included CGH array, next-generation sequencing, and whole transcriptome sequencing.
RESULTS
CGH array revealed a 180 kb deletion located upstream of SPG11. Sequencing of SPG11 uncovered two rare single nucleotide variants: the novel variant c.3143C>T in exon 17 (in cis with the deletion), and the previously reported pathogenic variant c.6409C>T in exon 34 (in trans). Whole transcriptome sequencing revealed that the variant c.3143C>T caused exon 17 skipping.
CONCLUSION
We report a novel sequence variant in the SPG11 gene resulting in exon 17 skipping, which, along with a nonsense variant, causes Spastic Paraplegia 11 in our proband. In addition, a deletion upstream of SPG11 was identified in the patient, whose implication in the phenotype remains uncertain. Nonetheless, the deletion apparently affects cis-regulatory elements of the gene, suggesting a potential new pathogenic mechanism underlying the disease in a subset of undiagnosed patients. Our findings further support the hypothesis that the origin of thin corpus callosum in patients with SPG11 is of progressive nature.
Topics: Humans; Female; Adult; Spastic Paraplegia, Hereditary; Exons; Proteins; Codon, Nonsense; Corpus Callosum; Sequence Deletion; Phenotype
PubMed: 38938072
DOI: 10.1002/mgg3.2475 -
Animal Bioscience Jun 2024This study aimed to identify, discover and explore the characteristics of the mtDNA genomes of Cemani chicken (Gallus gallus).
OBJECTIVE
This study aimed to identify, discover and explore the characteristics of the mtDNA genomes of Cemani chicken (Gallus gallus).
METHODS
This study used gDNA of Cemani chicken isolated from liver tissue. mtDNA sequencing was performed using WGS mtDNA analysis with nanopore technology by Oxford Nanopore Technologies GridION. Bioinformatics and data analysis were then performed.
RESULTS
This study showed that the length of the mtDNA genome is 16,789 bp, consisting of two ribosomal RNA (12S rRNA, 16S rRNA), 22 transfer RNA genes (trnR, trnG, trnK, trnD, trnS, trnY, trnC, trnN, trnA, trnW, trnM, trnQ, trnl, trnL, trnV, trnF, trnP, trnT, trnE, trnL, trnS, trnH), 13 protein-coding genes (PCGs) (ND4l, ND3, COX3, ATP6, ATP8, COX2, COX1, ND2, ND1, CYTB, ND6, ND5, ND4), and a noncoding control region (Dloop). Furthermore, analysis showed there were polymorphic sites and amino acid alterations when mtDNA Cemani chicken was aligned with references from GenBank.
CONCLUSION
Site (988T>*) in Dloop genes and (328A>G) in ND3 genes which alter glycine to stop codon, were specific markers found only in Cemani chicken.
PubMed: 38938041
DOI: 10.5713/ab.23.0513 -
Molecular Therapy : the Journal of the... Jun 2024Gene editing technologies hold promise for enabling the next generation of adoptive cellular therapies. Conventional gene editing platforms that rely on nuclease...
Gene editing technologies hold promise for enabling the next generation of adoptive cellular therapies. Conventional gene editing platforms that rely on nuclease activity, such as Clustered regularly interspaced short palindromic repeats-CRISPR associated protein 9 (CRISPR-Cas9), allow efficient introduction of genetic modifications; however, these modifications occur via the generation of DNA double-strand breaks (DSBs) and can lead to unwanted genomic alterations and genotoxicity. Here, we apply a novel modular RNA aptamer-mediated Pin-point™ base editing platform to simultaneously introduce multiple gene knockouts and site-specific integration of a transgene in human primary T cells. We demonstrate high editing efficiency and purity at all target sites and significantly reduced frequency of chromosomal translocations compared to the conventional CRISPR-Cas9 system. Site-specific knock-in of a chimeric antigen receptor (CAR) and multiplex gene knockout are achieved within a single intervention and without the requirement for additional sequence-targeting components. The ability to perform complex genome editing efficiently and precisely highlights the potential of the Pin-point platform for application in a range of advanced cell therapies.
PubMed: 38937969
DOI: 10.1016/j.ymthe.2024.06.033 -
Plant Disease Jun 2024During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas,...
During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas, USA and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Laurel, Maryland for pathogen identification and confirmatory testing. Ribo-depleted libraries for all four samples were prepared for high-throughput sequencing (HTS) analysis, using the RNA extracts of individual grapefruit samples. HTS yielded 13.6 to 22.8 million 75 bp paired-end raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (GenBank accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, a few Caulimoviridae and Retroviridae contigs were also identified in the libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. To know the association of chlorotic blotch symptoms with NeVM, 12 symptomatic and 4 non-symptomatic grapefruit samples were collected for testing (Supplementary Figure 1). A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´)/NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a detection assay. The results of the 671 bp amplicon sequencing showed that 13 (12+1) of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 87.63-92.25% nt identities with the nectarine isolates of NeVM (KT273411-13) and 78% with the Canadian prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived 2019 (TX4) and 2023 leaf tissue samples (LF1 and LF2) from La Feria, TX were selected for genetic analysis. The primer pair Marafi Gen-1F/NeVM-1R targeting the helicase domain of NeVM, successfully amplified the expected 671 bp product. The amplicon sequence of isolate TX4 shared 97.76% and 89.87% nt identities with isolates LF1 and LF2, respectively, while LF1 shared 90.76% nt identity with LF2. Sequence variation was observed for a 1906 bp overlapping amplicon obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´)/Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG3´), spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of TX4 shared 94 and 95% nt identities with LF2 and LF1, respectively, but only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91.08 to 92.29% nt identity with American prunus isolates (KT273411-13) and 75% nt identity with Canadian isolate (MZ291915). Three sequences of 671 bp and 1906 bp amplicons were deposited in GenBank under accession numbers PP767656-61. From the regulatory point of view, NeVM fails to satisfy the criteria to be considered as potential quarantine pests for the European Union because of the absence of information on its biology, distribution, and economic impact (Bragard et al., 2019). However, this report expands the natural host range of NeVM to include grapefruit. From an epidemiological standpoint, more data on host range, varietal susceptibility, and genetic variability among citrus and prunus isolates are needed to conclude the association of NeVM infection with symptoms development.
PubMed: 38937932
DOI: 10.1094/PDIS-05-24-1024-PDN -
Plant Disease Jun 2024The first tri-segmented viruses in the family Rhabdoviridae were recently discovered by exploring publicly available plant datasets in several hosts, including alfalfa...
The first tri-segmented viruses in the family Rhabdoviridae were recently discovered by exploring publicly available plant datasets in several hosts, including alfalfa (Medicago sativa L.) (Bejerman et al. 2023). They were classified in a novel genus "Trirhavirus" within the family Rhabdoviridae. The trirhavirus identified in alfalfa was named Medicago trirhavirus 1 (MeTRV1). Here we report the first confirmation of MeTRV1 in commercial alfalfa fields in Washington State, USA. Samples were collected in 2019-2021 in Benton and Grant Counties, WA. The alfalfa leaves in which the virus was detected displayed irregular chlorotic spotting (Fig.1). Total RNA extraction, library preparation, high throughput sequencing, and bioinformatics analysis were performed as described in Nemchinov et al (2023). Raw reads were trimmed with Trimmomatic 0.39 (Bolger at al. 2014). SPAdes 3.15.5 (Bankevich et al. 2012) was used for assembly. MeTRV1 was identified in four plants out of 100 tested and three complete RNA segments were recovered from one of them. For clarity, the virus found in the alfalfa field samples was designated MeTRV1-Wa. De novo assembly resulted in three contigs, which, when subjected to BLASTn analyses, aligned to the respective RNA segments of MeTRV1. The first contig was 6,498 nucleotides (nts)-long, 99.4% identical to RNA1 of MeTRV1 (BK064256.1), and 5,922 reads mapped to it (coverage 125x). RNA1 of MeTRV1-Wa encoded a protein 2,040 amino acid (aa)-long that aligned with protein L of MeTRV1 (DBA36559.1, 99.8%). The second contig was 4,014 nts-long and 95.2% identical to the RNA2 of MetRV1 (BK064257.1) with 1,751 reads mapping (coverage 59x). It contained four open reading frames (ORFs) encoding proteins N (445 aa, 99.8%, DBA36560.1); P2 (343 aa, 99.4%, DBA36561.1); P3 (183 aa, 99.4%, DBA36562.1); and P4 (72 aa, 98.6%, DBA36563.1). Altogether, 4,653 reads mapped to the third contig (coverage 131x) that was 4,889 nts-long and 99.1% identical to the RNA 3 segment of MeTRV1 (BK064258.1). RNA3 of MeTRV1-Wa encoded four proteins: P6 (274 aa, 100%, DBA36565.1); P7 (189 aa, 99.5%, DBA36566.1); P8 (514 aa, 99 %, DBA36567.1); and P5 (303 aa, 99.7%, DBA36564.1). The 5' trailer of each RNA segment had a nearly identical 24 nts at the end. Genomic organization of the MeTRV1-Wa and the locations of its ORFs are shown in Fig.2. To confirm the virus's presence, two sets of primers were designed based on the predicted sequence of the viral RNA 3 segment. The correct-size products were amplified in RT-PCR assays with RNA extracted from infected plants (Fig.3) and verified by Sanger sequencing. Besides MeTRV1-Wa, sequences of the following viruses known to cause symptoms in alfalfa were identified in the same library: alfalfa mosaic virus, bean leafroll virus, lucerne transient streak virus, and pea streak virus. Thus, the observed symptomatology may not be clearly attributed to MeTRV1-Wa due to coinfecting organisms. However, a possible association of the disease symptoms with the virus presence could be suggested based on comparison with both asymptomatic and symptomatic plants negative for MeTRV1-Wa (Fig.1). Since plant rhabdoviruses are recognized as a cause of economic losses in alfalfa and other major crops and are transmitted by insects (Bejerman et al. 2011, 2015; Jackson et al. 2005; Man and Dietzgen 2014), this first experimental confirmation of the occurrence of the new virus in the U.S. alfalfa is important for understanding its origin, distribution, and pathogenic potential.
PubMed: 38937929
DOI: 10.1094/PDIS-05-24-1132-PDN -
Military Medical Research Jun 2024Extracellular adenosine triphosphate (ATP) is an important signal molecule. In previous studies, intensive research had revealed the crucial roles of family with...
BACKGROUND
Extracellular adenosine triphosphate (ATP) is an important signal molecule. In previous studies, intensive research had revealed the crucial roles of family with sequence similarity 3 member A (FAM3A) in controlling hepatic glucolipid metabolism, islet β cell function, adipocyte differentiation, blood pressure, and other biological and pathophysiological processes. Although mitochondrial protein FAM3A plays crucial roles in the regulation of glucolipid metabolism via stimulating ATP release to activate P2 receptor pathways, its mechanism in promoting ATP release in hepatocytes remains unrevealed.
METHODS
db/db, high-fat diet (HFD)-fed, and global pannexin 1 (PANX1) knockout mice, as well as liver sections of individuals, were used in this study. Adenoviruses and adeno-associated viruses were utilized for in vivo gene overexpression or inhibition. To evaluate the metabolic status in mice, oral glucose tolerance test (OGTT), pyruvate tolerance test (PTT), insulin tolerance test (ITT), and magnetic resonance imaging (MRI) were conducted. Protein-protein interactions were determined by coimmunoprecipitation with mass spectrometry (MS) assays.
RESULTS
In livers of individuals and mice with steatosis, the expression of ATP-permeable channel PANX1 was increased (P < 0.01). Hepatic PANX1 overexpression ameliorated the dysregulated glucolipid metabolism in obese mice. Mice with hepatic PANX1 knockdown or global PANX1 knockout exhibited disturbed glucolipid metabolism. Restoration of hepatic PANX1 rescued the metabolic disorders of PANX1-deficient mice (P < 0.05). Mechanistically, ATP release is mediated by the PANX1-activated protein kinase B-forkhead box protein O1 (Akt-FOXO1) pathway to inhibit gluconeogenesis via P2Y receptors in hepatocytes. PANX1-mediated ATP release also activated calmodulin (CaM) (P < 0.01), which interacted with c-Jun N-terminal kinase (JNK) to inhibit its activity, thereby deactivating the transcription factor activator protein-1 (AP1) and repressing fatty acid synthase (FAS) expression and lipid synthesis (P < 0.05). FAM3A stimulated the expression of PANX1 via heat shock factor 1 (HSF1) in hepatocytes (P < 0.05). Notably, FAM3A overexpression failed to promote ATP release, inhibit the expression of gluconeogenic and lipogenic genes, and suppress gluconeogenesis and lipid deposition in PANX1-deficient hepatocytes and livers.
CONCLUSIONS
PANX1-mediated release of ATP plays a crucial role in maintaining hepatic glucolipid homeostasis, and it confers FAM3A's suppressive effects on hepatic gluconeogenesis and lipogenesis.
Topics: Animals; Connexins; Mice; Gluconeogenesis; Nerve Tissue Proteins; Adenosine Triphosphate; Lipogenesis; Liver; Mice, Knockout; Male; Humans; Diet, High-Fat; Cytokines
PubMed: 38937853
DOI: 10.1186/s40779-024-00543-6 -
BMC Medical Genomics Jun 2024TTN is a complex gene with large genomic size and highly repetitive structure. Pathogenic variants in TTN have been reported to cause a range of skeletal muscle and...
BACKGROUND
TTN is a complex gene with large genomic size and highly repetitive structure. Pathogenic variants in TTN have been reported to cause a range of skeletal muscle and cardiac disorders. Homozygous or compound heterozygous mutations tend to cause a wide spectrum of phenotypes with congenital or childhood onset. The onset and severity of the features were considered to be correlated with the types and location of the TTN variants.
METHODS
Whole-exome sequencing was performed on three unrelated families presenting with fetal akinesia deformation sequence (FADS), mainly characterized by reduced fetal movements and limb contractures. Sanger sequencing was performed to confirm the variants. RT-PCR analysis was performed.
RESULTS
TTN c.38,876-2 A > C, a meta transcript-only variant, with a second pathogenic or likely pathogenic variant in trans, was observed in five affected fetuses from the three families. Sanger sequencing showed that all the fetal variants were inherited from the parents. RT-PCR analysis showed two kinds of abnormal splicing, including intron 199 extension and skipping of 8 bases.
CONCLUSIONS
Here we report on three unrelated families presenting with FADS caused by four TTN variants. In addition, our study demonstrates that pathogenic meta transcript-only TTN variant can lead to defects which is recognizable prenatally in a recessive manner.
Topics: Humans; Female; Connectin; Pedigree; Male; Exome Sequencing; Arthrogryposis; Contracture; Mutation; Pregnancy; Fetus; Adult
PubMed: 38937733
DOI: 10.1186/s12920-024-01946-z