-
Fish Physiology and Biochemistry Feb 2022Egg biochemical composition is among the main factors affecting offspring quality and survival during the yolk-sac stage, when larvae depend exclusively on yolk...
Egg biochemical composition is among the main factors affecting offspring quality and survival during the yolk-sac stage, when larvae depend exclusively on yolk nutrients. These nutrients are primarily embedded in the developing oocytes during vitellogenesis. In aquaculture, assisted reproduction procedures may be applied enabling gamete production. For the European eel (Anguilla anguilla), reproductive treatment involves administration of pituitary extracts from carp (CPE) or salmon (SPE) to induce and sustain vitellogenesis. In the present study, we compared the influence of CPE and SPE treatments on offspring quality and composition as well as nutrient utilization during the yolk-sac stage. Thus, dry weight, proximal composition (total lipid, total protein), free amino acids, and fatty acids were assessed in eggs and larvae throughout the yolk-sac stage, where body and oil-droplet area were measured to estimate growth rate, oil-droplet utilization, and oil-droplet utilization efficiency. The results showed that CPE females spawned eggs with higher lipid and free amino acid contents. However, SPE females produced more buoyant eggs with higher fertilization rate as well as larger larvae with more energy reserves (estimated as oil-droplet area). Overall, general patterns of nutrient utilization were detected, such as the amount of total lipid and monounsaturated fatty acids decreasing from the egg stage and throughout the yolk-sac larval stage. On the contrary, essential fatty acids and free amino acids were retained. Notably, towards the end of the yolk-sac stage, the proximal composition and biometry of surviving larvae, from both treatments, were similar.
Topics: Amino Acids; Anguilla; Animals; Cell Extracts; Fatty Acids; Female; Hormones; Larva; Ovum; Pituitary Gland; Vitellogenesis; Yolk Sac
PubMed: 35044583
DOI: 10.1007/s10695-021-01042-4 -
Frontiers in Endocrinology 2021Red pigment concentrating hormone (RPCH) and pigment dispersing hormone (PDH) are crustacean neuropeptides involved in broad physiological processes including body color...
Red pigment concentrating hormone (RPCH) and pigment dispersing hormone (PDH) are crustacean neuropeptides involved in broad physiological processes including body color changes, circadian rhythm, and ovarian growth. In this study, the full-length cDNA of and were identified from the brain of the Chinese mitten crab . The deduced RPCH and PDH mature peptides shared identical sequence to the adipokinetic hormone/RPCH peptides family and the β-PDH isoforms and were designated as Es-RPCH and Es-β-PDH, respectively. and transcripts were distributed in the brain and eyestalks. The positive signals of and were localized in the neuronal clusters 6, 8, 9, 10, and 17 of the brain as revealed by hybridization. The expression level of and mRNA in nervous tissues were all significantly increased at vitellogenic stage, and then decreased at the final meiotic maturation stage. The administrated with synthesized Es-RPCH peptide results in germinal vesicles shift toward the plasma membrane in vitellogenic oocyte, and significant decrease of the gonad-somatic index (GSI) and mean oocyte diameter as well as the expression of vitellogenin mRNA at 30 days post injection . Similar results were also found when injection of the Es-β-PDH peptide. culture demonstrated that Es-RPCH and Es-β-PDH induced germinal vesicle breakdown of the late vitellogenic oocytes. Comparative ovarian transcriptome analysis indicated that some reproduction/meiosis-related genes such as cdc2 kinase, cyclin B, 5-HT-R and retinoid-X receptor were significantly upregulated in response to Es-RPCH and Es-β-PDH treatments. Taken together, these results provided the evidence for the inductive effect of and on the oocyte meiotic maturation in .
Topics: Animals; Brachyura; Brain Chemistry; China; DNA, Complementary; Female; Gene Expression; Meiosis; Oligopeptides; Oocytes; Ovary; Peptides; Pyrrolidonecarboxylic Acid; RNA, Messenger; Vitellogenesis
PubMed: 34975771
DOI: 10.3389/fendo.2021.802768 -
Frontiers in Endocrinology 2021In this study, a novel Crustacean Hyperglycemic Hormone-type II gene was identified and biologically characterized in a shrimp, . Based on its structure and function,...
In this study, a novel Crustacean Hyperglycemic Hormone-type II gene was identified and biologically characterized in a shrimp, . Based on its structure and function, this gene was named (). The complete cDNA sequence of consisted of 1,022 nt with an open reading frame (ORF) of 339 nt encoding a polypeptide of 112 amino acids. It was classified as a member of the CHH-type II family based on conserved cysteine residues, a characteristically positioned glycine residue, and the absence of CHH precursor-related peptide (CPRP) domain. The deduced mature PemVIH shared the highest sequence similarities with giant river prawn sinus gland peptide A. Unlike (), was expressed only in the brain and ventral nerve cord, but not the eyestalks. Whole mount immunofluorescence using a newly generated PemVIH antiserum detected positive signals in neuronal cluster 9/11 and 17 of the brain, commissural ganglion (CoG), and neuronal clusters of ventral nerve cord. The presence of PemVIH-positive neurons in CoG, a part of stomatogastric nervous system, suggested a potential mechanism for crosstalk between nutritional and reproductive signaling. The role of in vitellogenesis was evaluated using RNA interference technique. Temporal knockdown of in female subadults resulted in a 3-fold increase in ovarian vitellogenin expression, suggesting an inhibitory role of in vitellogenesis. This study provided novel insight into the control of vitellogenesis and additional strategies for improving ovarian maturation in without the current harmful practice of eyestalk ablation.
Topics: Amino Acid Sequence; Animals; Arthropod Proteins; Cloning, Molecular; Female; Invertebrate Hormones; Nerve Tissue Proteins; Ovary; Penaeidae; Vitellogenesis; Vitellogenins
PubMed: 34867802
DOI: 10.3389/fendo.2021.760538 -
Ecotoxicology and Environmental Safety Nov 2021Ammonia is a common environmental pollutant in aquatic ecosystem and is also a significant concern in closed aquaculture systems. The threat of ammonia has been...
Ammonia is a common environmental pollutant in aquatic ecosystem and is also a significant concern in closed aquaculture systems. The threat of ammonia has been increasing with rising anthropogenic activities including intensified aquaculture. In this study, we aimed to investigate ammonia toxicity and metabolism mechanisms in the hepatopancreas, a major organ for Vitellogenin (Vtg) synthesis and defending against ammonia stress, of female swimming crab Portunus trituberculatus which is an important fishery and aquaculture species, by integrating physiological, transcriptome and metabolome analyses. The results revealed that ammonia exposure (10 mg/L, an environmentally relevant concentration) resulted in a remarkable reduction in vtg expression and depression of multiple signaling pathways for reproductive regulators including methyl farnesoate, ecdysone and neuroparsin, demonstrating for the first time that ammonia impairs swimming crab female reproduction. In addition, a number of important genes and metabolites in glycolysis, the Krebs cycle, fatty acid β-oxidation and synthesis were significantly downregulated, indicating that changes in ammonia levels lead to a general depression of energy metabolism in hepatopancreas. After ammonia exposure, an increased level of urea and a reduction of amino acid catabolism were observed in hepatopancreas, suggesting that urea cycle was utilized to biotransform ammonia, and amino acid catabolism was decreased to reduce endogenous ammonia generation. Furthermore, antioxidant systems were altered following ammonia exposure, which was accompanied by proteins and lipid oxidations, as well as cellular apoptosis. These results indicate that ammonia leads to metabolic suppression, oxidative stress and apoptosis in P. trituberculatus hepatopancreas. The findings improve the understanding for the mechanisms of ammonia toxicity and metabolism in P. trituberculatus, and provide valuable information for assessing potential ecological risk of environmental ammonia and improving aquaculture management.
PubMed: 34839137
DOI: 10.1016/j.ecoenv.2021.113026 -
Insects Oct 2021Silkworm larval-pupal metamorphosis and the first half of pupal-adult development occur during oogenesis from previtellogenesis to vitellogenesis and include two peaks...
Silkworm larval-pupal metamorphosis and the first half of pupal-adult development occur during oogenesis from previtellogenesis to vitellogenesis and include two peaks of the hemolymph ecdysteroid titer. Moreover, a rise in 20-hydroxyecdysone titer in early pupae can trigger the first major transition from previtellogenesis to vitellogenesis in silkworm oogenesis. In this study, we first investigated the expression patterns of 66 maternal genes in the ovary at the wandering stage. We then examined the developmental expression profiles in six time-series samples of ovaries or ovarioles by reverse transcription-quantitative PCR. We found that the transcripts of 22 maternal genes were regulated by 20-hydroxyecdysone in the isolated abdomens of the pupae following a single injection of 20-hydroxyecdysone. This study is the first to determine the relationship between 20-hydroxyecdysone and maternal genes during silkworm oogenesis. These findings provide a basis for further research into the embryonic development of .
PubMed: 34821770
DOI: 10.3390/insects12110969 -
Scientific Reports Oct 2021For sea snakes as for many types of animals, long-term studies on population biology are rare and hence, we do not understand the degree to which annual variation in...
For sea snakes as for many types of animals, long-term studies on population biology are rare and hence, we do not understand the degree to which annual variation in population sizes is driven by density-dependent regulation versus by stochastic abiotic factors. We monitored three populations of turtle-headed sea snakes (Emydocephalus annulatus) in New Caledonia over an 18-year period. Annual recruitment (% change in numbers) showed negative density-dependence: that is, recruitment increased when population densities were low, and decreased when densities were high. Windy weather during winter increased survival of neonates, perhaps by shielding them from predation; but those same weather conditions reduced body condition and the reproductive output of adult snakes. The role for density-dependence in annual dynamics of these populations is consistent with the slow, K-selected life-history attributes of the species; and the influence of weather conditions on reproductive output suggests that females adjust their allocation to reproduction based on food availability during vitellogenesis.
Topics: Animals; Elapidae; Female; Hydrophiidae; New Caledonia; Population Density; Population Dynamics; Reproduction; Seasons
PubMed: 34667211
DOI: 10.1038/s41598-021-00245-2 -
BMC Biology Oct 2021The zinc-finger transcription factor Krüppel-homolog 1 (Kr-h1) exerts a dual regulatory role during insect development by preventing precocious larval/nymphal...
BACKGROUND
The zinc-finger transcription factor Krüppel-homolog 1 (Kr-h1) exerts a dual regulatory role during insect development by preventing precocious larval/nymphal metamorphosis and in stimulating aspects of adult reproduction such as vitellogenesis. However, how Kr-h1 functions both as a transcriptional repressor in juvenile metamorphosis and an activator in adult reproduction remains elusive. Here, we use the insect Locusta migratoria to dissect the molecular mechanism by which Kr-h1 functions as activator and repressor at these distinct developmental stages.
RESULTS
We report that the kinase PKCα triggers Kr-h1 phosphorylation at the amino acid residue Ser, a step essential for its dual functions. During juvenile stage, phosphorylated Kr-h1 recruits a corepressor, C-terminal binding protein (CtBP). The complex of phosphorylated Kr-h1 and CtBP represses the transcription of Ecdysone induced protein 93F (E93) and consequently prevents the juvenile-to-adult transition. In adult insects, phosphorylated Kr-h1 recruits a coactivator, CREB-binding protein (CBP), and promotes vitellogenesis by inducing the expression of Ribosomal protein L36. Furthermore, Kr-h1 phosphorylation with the concomitant inhibition of E93 transcription is evolutionarily conserved across insect orders.
CONCLUSION
Our results suggest that Kr-h1 phosphorylation is indispensable for the recruitment of transcriptional cofactors, and for its anti-metamorphic and vitellogenic actions in insects. Our data shed new light on the understanding of Kr-h1 regulation and function in JH-regulated insect metamorphosis and reproduction.
Topics: Animals; Gene Expression Regulation, Developmental; Insect Proteins; Insecta; Juvenile Hormones; Kruppel-Like Transcription Factors; Metamorphosis, Biological; Phosphorylation; Transcription Factors; Vitellogenesis
PubMed: 34625063
DOI: 10.1186/s12915-021-01157-3 -
International Journal of Molecular... Sep 2021Although anti-Müllerian hormone (AMH) has classically been correlated with the regression of Müllerian ducts in male mammals, involvement of this growth factor in...
Although anti-Müllerian hormone (AMH) has classically been correlated with the regression of Müllerian ducts in male mammals, involvement of this growth factor in other reproductive processes only recently come to light. Teleost is the only gnathostomes that lack Müllerian ducts despite having orthologous genes. In adult teleost gonads, Amh exerts a role in the early stages of germ cell development in both males and females. Mechanisms involving the interaction of Amh with gonadotropin- and growth factor-induced functions have been proposed, but our overall knowledge regarding Amh function in fish gonads remains modest. In this study, we report on Amh actions in the European sea bass ovary. Amh and type 2 Amh receptor (Amhr2) are present in granulosa and theca cells of both early and late-vitellogenic follicles and cannot be detected in previtellogenic ovaries. Using the system a recombinant sea bass Amh has been produced that is endogenously processed to generate a 12-15 kDa bioactive mature protein. Contrary to previous evidence in lower vertebrates, in explants of previtellogenic sea bass ovaries, mature Amh has a synergistic effect on steroidogenesis induced by the follicle-stimulating hormone (Fsh), increasing E2 and levels.
Topics: Animals; Anti-Mullerian Hormone; Bass; COS Cells; Chlorocebus aethiops; Estradiol; Female; Follicle Stimulating Hormone; Gonadotropins; Gonads; Granulosa Cells; Immunoassay; Ovarian Follicle; Ovary; Plasmids; Receptors, Peptide; Receptors, Transforming Growth Factor beta; Recombinant Proteins; Steroids; Theca Cells; Vitellogenesis
PubMed: 34576257
DOI: 10.3390/ijms221810092 -
Proceedings of the National Academy of... Sep 2021It is well documented that the juvenile hormone (JH) can function as a gonadotropic hormone that stimulates vitellogenesis by activating the production and uptake of...
It is well documented that the juvenile hormone (JH) can function as a gonadotropic hormone that stimulates vitellogenesis by activating the production and uptake of vitellogenin in insects. Here, we describe a phenotype associated with mutations in the JH receptor genes, and : the accumulation of mature eggs with reduced egg length in the ovary. JH signaling is mainly activated in ovarian muscle cells and induces gene expression in these cells. Meanwhile, JH signaling induces gene expression in the adult fat body, from which collagen IV is secreted and deposited onto the ovarian muscles. Laminin locally and collagen IV remotely contribute to the assembly of ovarian muscle extracellular matrix (ECM); moreover, the ECM components are indispensable for ovarian muscle contraction. Furthermore, ovarian muscle contraction externally generates a mechanical force to promote ovulation and maintain egg shape. This work reveals an important mechanism for JH-regulated insect reproduction.
Topics: Animals; Basic Helix-Loop-Helix Transcription Factors; Collagen Type IV; Drosophila Proteins; Drosophila melanogaster; Extracellular Matrix; Extracellular Matrix Proteins; Female; Juvenile Hormones; Laminin; Mutation; Oocytes; Oogenesis; Ovulation; Transcription Factors; Vitellogenesis; Vitellogenins
PubMed: 34544864
DOI: 10.1073/pnas.2104461118 -
Frontiers in Physiology 2021Vitellogenins (Vgs) are yolk protein precursors that are regulated by juvenile hormone (JH) and/or 20-hydroxyecdysone (20E) in insects. JH acts as the principal...
Vitellogenins (Vgs) are yolk protein precursors that are regulated by juvenile hormone (JH) and/or 20-hydroxyecdysone (20E) in insects. JH acts as the principal gonadotropin that stimulates vitellogenesis in hemimetabolous insects. In this study, we cloned and characterized the () promoter. Multiple sites for putative transcription factor binding were predicted for the 1,804 bp promoter region, such as the Broad-Complex, ecdysone response element (EcRE), GATA, Hairy, JH response element (JHRE), and Methoprene (Met)-binding motif, among others. Luciferase reporter assay has identified that construct -177 bp is enough to support JH III induction but not 20E suppression. This 38 bp region (from -177 to -139 bp) contains two conserved response element half-sites separated by 2 nucleotides spacer (DR2) and is designated as RE (GAGTCACGGAGTCGCCGCTG). Mutation assay and luciferase assay data using mutated constructs verified the crucial role of G residues in RE for binding the isolated fat body nuclear protein. In 9 cells, a luciferase reporter placed under the control of a minimal promoter containing RE was induced by JH III in a dose- and time-dependent manner. Nuclear proteins isolated from previtellogenic female fat body cells bound to RE, and this binding was outcompeted by a 50-fold excess of cold DR4 and JH binding protein response elements (Chorion factor-I/Ultraspiracle). Affinity pull-down experiment with nuclear extracts of previtellogenic female fat body, using 31-bp probe RE as bait, yielded a 71 kDa candidate nuclear protein that may mediate the regulatory action of the JH III.
PubMed: 34526913
DOI: 10.3389/fphys.2021.723072