-
Healthcare (Basel, Switzerland) Jan 2024Human-centric artificial intelligence (HCAI) aims to provide support systems that can act as peer companions to an expert in a specific domain, by simulating their way...
BACKGROUND
Human-centric artificial intelligence (HCAI) aims to provide support systems that can act as peer companions to an expert in a specific domain, by simulating their way of thinking and decision-making in solving real-life problems. The gynaecological artificial intelligence diagnostics (GAID) assistant is such a system. Based on artificial intelligence (AI) argumentation technology, it was developed to incorporate, as much as possible, a complete representation of the medical knowledge in gynaecology and to become a real-life tool that will practically enhance the quality of healthcare services and reduce stress for the clinician. Our study aimed to evaluate GAIDS' efficacy and accuracy in assisting the working expert gynaecologist during day-to-day clinical practice.
METHODS
Knowledge-based systems utilize a knowledge base (theory) which holds evidence-based rules ("IF-THEN" statements) that are used to prove whether a conclusion (such as a disease, medication or treatment) is possible or not, given a set of input data. This approach uses argumentation frameworks, where rules act as claims that support a specific decision (arguments) and argue for its dominance over others. The result is a set of admissible arguments which support the final decision and explain its cause.
RESULTS
Based on seven different subcategories of gynaecological presentations-bleeding, endocrinology, cancer, pelvic pain, urogynaecology, sexually transmitted infections and vulva pathology in fifty patients-GAID demonstrates an average overall closeness accuracy of zero point eighty-seven. Since the system provides explanations for supporting a diagnosis against other possible diseases, this evaluation process further allowed for a learning process of modular improvement in the system of the diagnostic discrepancies between the system and the specialist.
CONCLUSIONS
GAID successfully demonstrates an average accuracy of zero point eighty-seven when measuring the closeness of the system's diagnosis to that of the senior consultant. The system further provides meaningful and helpful explanations for its diagnoses that can help clinicians to develop an increasing level of trust towards the system. It also provides a practical database, which can be used as a structured history-taking assistant and a friendly, patient record-keeper, while improving precision by providing a full list of differential diagnoses. Importantly, the design and implementation of the system facilitates its continuous development with a set methodology that allows minimal revision of the system in the face of new information. Further large-scale studies are required to evaluate GAID more thoroughly and to identify its limiting boundaries.
PubMed: 38255110
DOI: 10.3390/healthcare12020223 -
Microbiological Research Apr 2024Vaginal infectious diseases caused by viruses and bacteria have been linked to the occurrence of dysbiosis, that is, a reduction in the abundance of the normally... (Review)
Review
A molecular view on the interference established between vaginal Lactobacilli and pathogenic Candida species: Challenges and opportunities for the development of new therapies.
Vaginal infectious diseases caused by viruses and bacteria have been linked to the occurrence of dysbiosis, that is, a reduction in the abundance of the normally dominating vaginal Lactobacillus species. Mucosal infections in the vagina and/or vulva caused by Candida species, usually known as vulvovaginal candidiasis (or VVC), are among the leading causes of diseases in the vaginal tract. The existence of a clear link between the occurrence of dysbiosis and the development of VVC is still unclear, although multiple observations point in that direction. Based on the idea that vaginal health is linked to a microbiota dominated by lactobacilli, several probiotics have been used in management of VVC, either alone or in combination with antifungals, having obtained different degrees of success. In most cases, the undertaken trials resorted to lactobacilli species other than those indigenous to the vaginal tract, although in vitro these vaginal species were shown to reduce growth, viability and virulence of Candida. In this paper we overview the role of lactobacilli and Candida in the vaginal micro- and myco-biomes, while discussing the results obtained in what concerns the establishment of interference mechanisms in vivo and the environmental factors that could determine that. We also overview the molecular mechanisms by which lactobacilli species have been shown to inhibit pathophysiology of Candida, including the description of the genes and pathways determining their ability to thrive in the presence of each other. In a time where concerns are increasing with the emergence of antifungal resistance and the slow pace of discovery of new antifungals, a thorough understanding of the molecular mechanisms underneath the anti-Candida effect prompted by vaginal lactobacilli is of utmost importance to assure a knowledge-based design of what can be a new generation of pharmaceuticals, eventually focusing therapeutic targets other than the usual ones.
Topics: Female; Humans; Candida; Lactobacillus; Antifungal Agents; Dysbiosis; Vagina; Candidiasis, Vulvovaginal; Candida albicans
PubMed: 38246122
DOI: 10.1016/j.micres.2024.127628 -
Clinical, Cosmetic and Investigational... 2024Necrotizing fasciitis is a rare, severe, rapidly progressing disease with a high mortality rate. We report a case of a 72-year female with erythematous pemphigus who...
Necrotizing fasciitis is a rare, severe, rapidly progressing disease with a high mortality rate. We report a case of a 72-year female with erythematous pemphigus who developed erythema, swelling and ulceration on right vulva, groin, and thigh. The early clinical manifestations of the patient were nonspecific and easily misdiagnosed as cellulitis. However, upon the occurrence of ulceration and necrosis, deep fungal infection, pyoderma gangrenosum or lymphoproliferative disorders were considered. The pathology suggested IgG4-related diseases, plasmacytoma et al. But at last, surgical exploration and postoperative pathology confirmed the diagnosis of necrotizing fasciitis. The patient recovered after multiple aggressive surgical debridement procedures and antibiotic therapy and the patient has been followed up for 2 years without recurrence. Clinicians should be vigilant about the possibility of necrotizing fasciitis in patients with erythema, pain, rapid ulceration of skin and soft tissue, particularly in immunocompromised individuals with long-term use of immunosuppressive agents. It is crucial for saving life by early multi-disciplinary consultation, prompt diagnosis, and aggressive treatment.
PubMed: 38234694
DOI: 10.2147/CCID.S443374 -
Annals of Medicine and Surgery (2012) Jan 2024Ecthyma contagiosum, sometimes referred to as human orf, is a zoonotic disease caused by the orf virus that is mostly acquired by coming into contact with diseased...
BACKGROUND
Ecthyma contagiosum, sometimes referred to as human orf, is a zoonotic disease caused by the orf virus that is mostly acquired by coming into contact with diseased animals such as sheep or goats. The orf virus, a DNA virus belonging to the Poxviridae family, infects epidermal keratinocytes via breaking down the skin barrier, which can be caused by burns or wounds. The accompanying characteristic skin lesions can take on a range of morphologies depending on the infection's stage; lesions that are crusted, papillomatous, maculopapular, targetoid, and nodular can occur before clearing up. In addition to the lips and corners of the mouth, infected animals may also have lesions on the neck, vulva, and teeth. Skin sores caused by Ecthyma contagiousum discharge the orf virus into the environment.
CASE PRESENTATION
A 4-month-old male infant with no medical history brought himself to the dermatology clinic with a minor fever and a skin lesion on his nose. An orf virus infection was discovered in the newborn through blood culture and PCR testing. For a subsequent infection, the patient received fusidic acid cream, an antibiotic, and an antipyretic. Following a follow-up of 3 months, the lesion vanished entirely.
CONCLUSION
Rarely, as in our instance, are orf nodules seen somewhere else than the hands. In order to appropriately treat a patient without fear, clinicians should keep this in mind, especially if they come up with a history similar to that of our patient.
PubMed: 38222745
DOI: 10.1097/MS9.0000000000001520 -
Journal of Obstetrics and Gynaecology... Apr 2024There is no consensus on the best option for the management of Bartholin's gland abscesses. This systematic review and meta-analysis aimed to compare the Word catheter... (Meta-Analysis)
Meta-Analysis Comparative Study Review
OBJECTIVE
There is no consensus on the best option for the management of Bartholin's gland abscesses. This systematic review and meta-analysis aimed to compare the Word catheter placement and marsupialization methods in the management of women with a cyst or abscess of the Bartholin's glands.
DATA SOURCES
The PubMed, Scopus, Embase, Web of Science, and Cochrane Library databases, as well as Google Scholar, were searched to retrieve articles published between January 1990 and July 2023, comparing the Word catheter treatment with marsupialization for women with a cyst or abscess of the Bartholin's glands.
STUDY SELECTION
Both observational studies and randomized controlled trials (RCTs) were included in this meta-analysis.
DATA EXTRACTION AND SYNTHESIS
After the review, out of 9 relevant articles, only 4 (2 observational studies and 2 RCTs) were included in this meta-analysis, providing the data of 735 patients (396 in the Word catheter group vs. 339 in the marsupialization group). The data was extracted from the selected articles, using a data extraction form. Comparison of the Word catheter and marsupialization methods suggested that the risk of recurrence was approximately 7.6% in the Word catheter group and 9.4% in the marsupialization group. The findings indicated no significant difference in the recurrence of cysts or abscesses when comparing the Word catheter treatment with marsupialization (odds ratio = 0.99, 95% confidence interval: 0.29-3.43, P = 0.990, I = 77%).
CONCLUSION
This meta-analysis found no significant difference in the rate of recurrence between the Word catheter and marsupialization methods. In general, marsupialization and Word catheter placement in the treatment of Bartholinitis seem to be equally effective.
Topics: Humans; Bartholin's Glands; Female; Abscess; Vulvar Diseases; Cysts
PubMed: 38215822
DOI: 10.1016/j.jogc.2024.102357 -
Cancer Causes & Control : CCC May 2024Populations with high cancer risk that are targeted for screening, education, and vaccination have been shown to increase rates of screening, which ultimately may...
PURPOSE
Populations with high cancer risk that are targeted for screening, education, and vaccination have been shown to increase rates of screening, which ultimately may improve timing of diagnosis and overall outcome for certain cancers. Spatial scan analysis provides a visual representation of areas with higher rates of disease. Limited research has used this methodology to assess HPV-associated cancers. Using, spatial scan statistics, our goal was to identify regions within Kentucky having significantly higher rates of HPV-associated tumors. These regions can be targeted for public health efforts in the form of education, vaccination, screening, and physician recruitment.
METHODS
The Kentucky Cancer Registry data from 1995 to 2016 and spatial scan statistics were used to identify county-level clusters with high-incidence of HPV-associated cancers after adjustment for age and sex. Anatomic sites included in this analysis were oropharynx, cervix, anus, penis, and vulva.
RESULTS
There was one high-rate cluster of oropharyngeal cancer, which was observed in the Louisville metropolitan region (Relative Risk [RR] = 1.24, p < 0.001). One high-rate cluster of anal and penile cancer incidence in men was identified that partially overlapped with the oropharyngeal cluster. There were five clusters of higher cervical, vulvar, and anal cancer incidence in females, one of which overlapped with the oropharyngeal cluster.
CONCLUSION
Overlapping clusters of HPV-associated cancers were identified at the county-level and included both urban and rural counties of Kentucky. Findings can assist in the design of public health interventions to increase screenings, promote vaccination, and recruit physicians in these regions to improve prevention, diagnosis, and early treatment of HPV-associated cancers.
Topics: Humans; Kentucky; Female; Papillomavirus Infections; Male; Incidence; Middle Aged; Adult; Registries; Papillomaviridae; Neoplasms; Aged; Spatial Analysis
PubMed: 38212533
DOI: 10.1007/s10552-023-01835-3 -
Plant Disease Jan 2024Coral dealbatus belonging to Crassulaceae, is a new kind of health care vegetable as both medicine and food (Qin et al., 2022). Because of its obvious health care...
Coral dealbatus belonging to Crassulaceae, is a new kind of health care vegetable as both medicine and food (Qin et al., 2022). Because of its obvious health care function, C. dealbatus was widely cultivated in China and market demand increased quickly. In August of 2022, a large number of C. dealbatus showed the symptoms of stunting and leaf yellowing in Dali county, Weinan, Shaanxi province, China (109°43'E, 34°36'N). Many galls were observed on the roots of infected plants, and females were observed under the plant epidermis. Infected roots and soil samples were collected, the females, males and second-stage juveniles (J2s) were isolated. The female had a spherical body with a protruding neck, the stylet of females was slender and curved toward the back slightly. The perineal pattern of female (n=20) was round or elliptical, with high and squared dorsal arch, without obvious lateral lines. Morphological measurements of females (n=20): body length (L)=782.09±54.54 ( 518.52 to 1137.76) μm, body width (W)=439.51±19.23 (336.51 to 551.74 ) μm, stylet length (ST)=15.39±0.67 (12.55 to 18.80) μm, stylet knob height (STKH)=2.02±0.09 (1.88 to 2.46) μm, stylet knob width (STKW)=3.69±0.15 (2.91to 4.58) μm, distance from dorsal esophageal gland orifice to base of stylet (DGO)=2.32±0.17 (1.77 to 3.48) μm, vulval slit length (V)=23.99±0.75 (20.71 to 28.83) μm, and vulval slit to anus distance (V') = 18.62±0.55 (14.95 to 21.20) μm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and had blunt tail that bended slightly towards the abdomen, stylet knobs were prominent, speculum were in pairs and acicular. Measurements of females (n=10) were: L=1377.82±198.09 (1040.66 to 1726.59) μm, W=37.32±4.49 (28.35 to 41.90) μm, ST=21.48±1.23 (19.69 to 23.51) μm, STKH=2.99±0.12 (2.82 to 3.23) μm, STKW=5.34±0.41 (4.64 to 6.06) μm, DGO=2.54±0.13 (2.31 to 2.77) μm. J2s had the following characteristics: L=435.57±40.75 (414.92 to 462.14) μm, W=16.73±2.62 (12.76 to 21.95) μm, ST=12.66±1.02 (10.68 to 14.76) μm, STKH=1.58±0.29 (1.07 to 1.98) μm, STKW=2.22±0.38 (1.63 to 2.70) μm, DGO=2.26±0.18 (2.03 to 2.70) μm, tail length(T)= 87.97±9.71 (72.98 to 92.53) μm, hyaline tail terminus (HT) = 12.44±2.21 (9.59 to 13.90) μm. The nematode had uniform morphological characteristics with Meloidogyne incognita (Orton Williams, 1973). DNA was extracted from ten single females, and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for identification of M. incognita (Kiewnick et al., 2013), and a 300bp fragment was amplified by this pair of primers, confirming the nematode was M. incognita. 18S rDNA gene was amplified using the primer pair 18S/26S (TTTCACTCGCCGTTACTAAGG/TTGATTACGTCCCTGCCCTTT) (Vrain et al.,1992), and the sequence was submitted to GenBank (GenBank Accession No. OR477177). Sequence aligment was conducted and showed 100% identical with the known sequence of M. incognita (GenBank Accession Nos. MH113856 and OQ269709). The result of identification was also confirmed by amplifying the sequence of NADH dehydrogenase subunit 5 (nad5) from mitochondrial DNA region using primers: NAD5-F/R(TATTTTTTGTTTGAGATATATTAG/TCGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A611bp fragment was amplified and the sequence (GenBank Accession No. OR520436) showed 100% identical with other M. incognita sequences (GenBank Accession Nos. OP753345 and MT683461). In order to determine the pathogenicity of the nematode, infestation test was conducted in greenhouse. Ten 20-day-old healthy plants were cultured in pots with sterilized soil respectively and 2000 J2 hatched from egg masses of M. incognita were inoculated to the root of the plant. Five non-inoculated healthy C. dealbatus were used as negative control. After cultured at 25℃ for 60 days, roots were galled as observed in the field, and the symptoms of the root inoculated artificially with M. incognita were the same as those in the field. The nematodes were collected from inoculated roots, and identified as M. incognita with the species-specific primers Mi2F4/Mi1R1. An average of 7362 J2 was recovered and the reproduction factor value was 3.68. No galls were observed in control plants. These results suggested that C. dealbatus is a host for M. incognita. To our knowledge, this is the first report of M. incognita parasitizing C. dealbatus. This finding may be important to C. dealbatus industry and appropriate strategies should be taken to deal with the spreading of M. incognita.
PubMed: 38190365
DOI: 10.1094/PDIS-09-23-1968-PDN -
Archives of Pathology & Laboratory... Jan 2024There have been exceedingly few reports of epidermodysplasia verruciformis (EV) or EV-like lesions in the vulva. We describe the first observation of vulvar lesions...
Synchronous Epidermodysplasia Verruciformis and Intraepithelial Lesion of the Vulva Is Caused by Coinfection With Alpha-Human Papillomavirus and Beta-Human Papillomavirus Genotypes and Facilitated by Mutations in Cell-Mediated Immunity Genes.
CONTEXT.—
There have been exceedingly few reports of epidermodysplasia verruciformis (EV) or EV-like lesions in the vulva. We describe the first observation of vulvar lesions displaying synchronous EV-like histology and conventional high-grade squamous intraepithelial lesion (HSIL), a finding hitherto unreported in medical literature.
OBJECTIVES.—
To describe this novel vulvar lesion with hybrid features of HSIL and EV, attempt to confirm the hypothesis of coinfection with α and β human papillomavirus (α-HPV and β-HPV) genotypes, and describe relevant underlying genetic mutations.
DESIGN.—
Cases were retrospectively selected from our institutional archive. Detailed review of clinical information, histologic examination, and whole genome sequencing (WGS) were performed.
RESULTS.—
Five samples from 4 different patients were included. Three of 4 patients had a history of either iatrogenic immune suppression or prior immune deficiency, and all 3 featured classic HSIL and EV changes within the same lesion. One patient had no history of immune disorders, presented with EV-like changes and multinucleated atypia of the vulva, and was the sole patient without conventional HSIL. By WGS, several uniquely mappable reads pointed toward infection with multiple HPV genotypes, including both α-HPVs and β-HPVs. Mutations in genes implicated in cell-mediated immunity, such as DOCK8, CARMIL2, MST1, and others, were also found.
CONCLUSIONS.—
We provide the first description of vulvar lesions harboring simultaneous HSIL and EV features in the English-language literature, a phenomenon explained by coinfection with α-HPV and β-HPV genotypes. The finding of EV-like changes in a vulvar specimen should prompt assessment of the patient's immune status.
PubMed: 38180082
DOI: 10.5858/arpa.2023-0193-OA -
Frontiers in Cellular and Infection... 2023
Topics: Female; Humans; Vulvodynia; Chronic Pain; Inflammation; Immunity, Innate
PubMed: 38145051
DOI: 10.3389/fcimb.2023.1338659 -
Pathogens (Basel, Switzerland) Nov 2023Human papillomavirus (HPV) is implicated in over 90% of cervical cancer cases, with factors like regional variability, HPV genotype, the population studied, HPV... (Review)
Review
Human papillomavirus (HPV) is implicated in over 90% of cervical cancer cases, with factors like regional variability, HPV genotype, the population studied, HPV vaccination status, and anatomical sample collection location influencing the prevalence and pathology of HPV-induced cancer. HPV-16 and -18 are mainly responsible for the progression of several cancers, including cervix, anus, vagina, penis, vulva, and oropharynx. The oncogenic ability of HPV is not only sufficient for the progression of malignancy, but also for other tumor-generating steps required for the production of invasive cancer, such as coinfection with other viruses, lifestyle factors such as high parity, smoking, tobacco chewing, use of contraceptives for a long time, and immune responses such as stimulation of chronic stromal inflammation and immune deviation in the tumor microenvironment. Viral evasion from immunosurveillance also supports viral persistence, and virus-like particle-based prophylactic vaccines have been licensed, which are effective against high-risk HPV types. In addition, vaccination awareness programs and preventive strategies could help reduce the rate and incidence of HPV infection. In this review, we emphasize HPV infection and its role in cancer progression, molecular and immunopathogenesis, host immune response, immune evasion by HPV, vaccination, and preventive schemes battling HPV infection and HPV-related cancers.
PubMed: 38133265
DOI: 10.3390/pathogens12121380