-
Skin Research and Technology : Official... Jan 2024To compare the efficacy and safety of autologous cultured melanocytes transplantation (CMT) and non-cultured epidermal cell suspension transplantation (NCES) in the...
Comparative outcomes of autologous cultured melanocytes transplantation and non-cultured epidermal cell suspension transplantation in piebaldism patients: A retrospective study.
PURPOSE
To compare the efficacy and safety of autologous cultured melanocytes transplantation (CMT) and non-cultured epidermal cell suspension transplantation (NCES) in the treatment of piebaldism.
PATIENTS AND METHODS
A retrospective study was conducted on 30 anatomically based lesions from nine piebaldism patients who underwent either CMT (n = 7) or NCES (n = 23) between 2018 and 2020. The extent of repigmentation and colour matching was evaluated in all recipient sites using a digital imaging analysis system. In addition, adverse effects have also been assessed by follow-up results.
RESULTS
More than 75% repigmentation was achieved in 100% (7/7) and 60.9% (14/23) of the 30 lesions with the CMT and NCES, respectively. There were significant differences between the two methods in terms of repigmentation. The majority of patients had colour mismatches, and there was no discernible difference between the two surgical techniques. Adverse reactions rarely occurred.
CONCLUSION
The present study suggested that autologous CMT may provide better repigmentation in piebaldism patients than NCES with no significant side effects.
Topics: Humans; Retrospective Studies; Piebaldism; Treatment Outcome; Vitiligo; Melanocytes
PubMed: 38225879
DOI: 10.1111/srt.13580 -
Molecular Vision 2023Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes....
PURPOSE
Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation.
METHODS
A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of . Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations.
RESULTS
Genetic analysis identified 11 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a mutation were found to present a typical or atypical phenotype of OA1. All patients with mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia.
CONCLUSIONS
We discovered seven novel mutations and four previously reported mutations of in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.
Topics: Humans; Albinism, Ocular; Eye Proteins; Genetic Diseases, X-Linked; Iris; Membrane Glycoproteins; Mutation; Nystagmus, Congenital; Pedigree
PubMed: 38222445
DOI: No ID Found -
Comparative Biochemistry and... 2024Albinism is a widespread departure from a typical body colouration due to altered melanin production. The Wels catfish (Silurus glanis) is among the largest freshwater...
Albinism is a widespread departure from a typical body colouration due to altered melanin production. The Wels catfish (Silurus glanis) is among the largest freshwater fish species in the world, and albino individuals occur both in the wild and in aquaculture. Here, we performed transcriptome-wide analysis of albino and normally pigmented S. glanis using four tissues (skin, dorsal fin, whole eye and liver) to identify genes associated with albinism by exploring patterns of differential expression (DE) and differential alternative splicing (DAS). Multi-tissue analyses revealed a large number of genes in skin (n = 1355) and fin (n = 614) tissue associated with the albino phenotype in S. glanis, while the number of DE genes in eye and liver tissues was lower (n = 188, n = 189, respectively). Several DE genes across multiple tissues were detected as the most promising candidates (e.g., hsp4, hsp90b1, raph1, uqcrfs1, adcy-family and wnt-family) potentially causally linked to the albino phenotype in Wels catfish. Moreover, our findings supported earlier observations of physiological differences between albino and normally pigmented individuals, particularly in energy metabolism and immune response. In contrast, there were only a few pigmentation-related genes observed among DAS genes (4 in skin, 2 in fin), the overlap between DAS and DE genes was low (n = 25) and did not include known pigmentation-related genes. This suggests that DAS and DE in Wels catfish are, to a large extent, independent processes, and the observed alternative splicing cases are probably not causally linked with albinism in S. glanis. This work provides the first transcriptome-wide multi-tissue insights into the albinism of Wels catfish and serves as a valuable resource for further understanding the genetic mechanisms of pigmentation in fish.
Topics: Animals; Alternative Splicing; Catfishes; Albinism; Transcriptome; Gene Expression Profiling
PubMed: 38218377
DOI: 10.1016/j.cbpb.2024.110941 -
Investigative Ophthalmology & Visual... Jan 2024Infantile nystagmus syndrome (INS) is a gaze-holding disorder characterized by conjugate, uncontrolled eye oscillations that can result in significant visual acuity...
PURPOSE
Infantile nystagmus syndrome (INS) is a gaze-holding disorder characterized by conjugate, uncontrolled eye oscillations that can result in significant visual acuity loss. INS is often associated with albinism, but the mechanism is unclear. Albino mice have nystagmus; however, a pigmented mouse with a tyr mutation making it phenotypically albino, the B6(CG)-Tyr(c-2J)/J (B6 albino), had not been tested. We tested optokinetic response (OKR) in B6 albino and control mice. RNA-Seq was performed on extraocular muscles (EOM), tibialis anterior (TA) muscle, abducens (CN6), and oculomotor (CN3) neurons to uncover molecular differences that may contribute to nystagmus.
METHODS
OKR was measured using an ISCAN system. RNA was isolated from four tissues to identify differentially expressed genes and validated with qPCR and immunohistochemistry. Ingenuity pathway analyses identified top biological pathways.
RESULTS
All B6 albino mice tested had nystagmus. Differential RNA expression analysis showed 383 genes differentially expressed in EOM, 70 in CN3, 20 in CN6, and 639 in the TA. Two genes were differentially expressed in all four tissues: wdfy1 and nnt. Differences were validated by qPCR and immunostaining.
CONCLUSIONS
The tyr mutation in B6 albino mice, genotypically pigmented and phenotypically albino, is sufficient to result in spontaneous nystagmus. The two genes with decreased expression in the B6 albino tissues examined, wdfy1 and nnt, have been implicated in mitochondrial dysfunction and stem cell maintenance in other systems. Their function in extraocular muscle is unknown. These studies suggest that this mouse model of nystagmus may allow molecular identification of candidate nystagmus-related genes.
Topics: Animals; Mice; RNA-Seq; Nystagmus, Pathologic; Nystagmus, Optokinetic; Oculomotor Muscles; RNA
PubMed: 38206276
DOI: 10.1167/iovs.65.1.26 -
Scientific Reports Jan 2024Aleutian disease (AD) is a multi-systemic infectious disease in American mink (Neogale vison) caused by Aleutian mink disease virus (AMDV). This study aimed to identify...
Aleutian disease (AD) is a multi-systemic infectious disease in American mink (Neogale vison) caused by Aleutian mink disease virus (AMDV). This study aimed to identify candidate regions and genes underlying selection for response against AMDV using whole-genome sequence (WGS) data. Three case-control selection signatures studies were conducted between animals (N = 85) producing high versus low antibody levels against AMDV, grouped by counter immunoelectrophoresis (CIEP) test and two enzyme-linked immunosorbent assays (ELISA). Within each study, selection signals were detected using fixation index (FST) and nucleotide diversity (θπ ratios), and validated by cross-population extended haplotype homozygosity (XP-EHH) test. Within- and between-studies overlapping results were then evaluated. Within-studies overlapping results indicated novel candidate genes related to immune and cellular responses (e.g., TAP2, RAB32), respiratory system function (e.g., SPEF2, R3HCC1L), and reproduction system function (e.g., HSF2, CFAP206) in other species. Between-studies overlapping results identified three large segments under strong selection pressure, including two on chromosome 1 (chr1:88,770-98,281 kb and chr1:114,133-120,473) and one on chromosome 6 (chr6:37,953-44,279 kb). Within regions with strong signals, we found novel candidate genes involved in immune and cellular responses (e.g., homologous MHC class II genes, ITPR3, VPS52) in other species. Our study brings new insights into candidate regions and genes controlling AD response.
Topics: Animals; Humans; Mink; Aleutian Mink Disease; Aleutian Mink Disease Virus; Chromosomes, Human, Pair 1; Chromosomes, Human, Pair 6
PubMed: 38200094
DOI: 10.1038/s41598-023-51039-7 -
Journal of Optometry 2024
Topics: Humans; Albinism; Photosensitivity Disorders
PubMed: 38178613
DOI: 10.1016/j.optom.2023.100499 -
International Journal For Equity in... Jan 2024Persons with albinism face challenges to their wellbeing, safety, and security, ranging from vision impairment and skin cancer to stigma and discrimination. In some...
BACKGROUND
Persons with albinism face challenges to their wellbeing, safety, and security, ranging from vision impairment and skin cancer to stigma and discrimination. In some regions, they also face human rights atrocities including mutilation and murder. Research on human rights and albinism is a relatively new field that has gained momentum since the United Nations appointment of an Independent Expert on the enjoyment of human rights by persons with albinism. In this paper, we present the results of a mixed methods study undertaken to identify priorities for research, advocacy, and policy on albinism and human rights.
METHODS
The first component was a synthesis of peer-reviewed and grey literatures at the nexus of albinism, spiritual/cultural beliefs and practices, and human rights. We then conducted a priority-setting survey, informed by Delphi methods, on extant knowledge-practice gaps and research, advocacy, and policy priorities. Inclusion criteria included demonstrated expertise in the field (e.g., peer-reviewed publications, funded research), membership on national or international associations, or advocacy (civil society organizations) of more than 2 years in albinism and human rights. Thereafter, we gathered leading researchers, policy-makers, and civil society stakeholders for a Roundtable to gain consensus on these priorities.
RESULTS
Access to skin and vision care, and education were not deemed high priority for research, likely because the evidence supporting the need for these is well established. However, they were priorities for advocacy and policy: what is needed is mobilization of this evidence through advocacy and implementation of such services (policy). Other social determinants of health (rurality, poverty, and gender equality) are present as subtext in the findings, more so than priorities for research, advocacy, or policy, despite their preponderance in the lives of persons with albinism. Research was prioritized on stigma and discrimination; advocacy; and witchcraft, but with some differentiation between Global North and Global South priorities. Priorities for research, advocacy, and policy vary in keeping with the explanatory frameworks at play, including how harmful practices and witchcraft are viewed.
CONCLUSIONS
The lived experience of albinism is profoundly shaped by the social determinants of health (SDOH). Threats to the security and well-being of persons with albinism should be viewed through a human rights lens that encompasses the explanatory frameworks at play.
Topics: Humans; Health Policy; Human Rights; Organizations; Social Determinants of Health; Albinism
PubMed: 38167082
DOI: 10.1186/s12939-023-02064-5 -
Plants (Basel, Switzerland) Dec 2023Albinism is a unique problem encountered in tissue culture experiments, but the underlying mechanism remains unclear in most bamboo species. In this study, we identified...
Albinism is a unique problem encountered in tissue culture experiments, but the underlying mechanism remains unclear in most bamboo species. In this study, we identified the putative regulatory genes in an albino mutant of using comparative physiology and transcriptome analysis. The degeneration of chloroplasts, low chlorophyll (Chl) content and reduced photosynthetic capacity were observed in albinotic compared to normal lines. A total of 6191 unigenes were identified that were clearly differentially expressed between albino and normal lines by transcriptome sequencing. Most genes related to chloroplast development (such as , ) and pigment biosynthesis (such as , , ) were downregulated significantly in albinotic lines, which might be responsible for the albino phenotype. Moreover, some transcription factors (TFs) such as PIF and GLK1 were identified to be involved in chloroplast development and Chl synthesis, indicating the involvement of putative regulatory pathways and in albinotic . Finally, the downregulation of some stress responsive TFs (like ICE1 and EREB1) suggested a reduction in stress resistance of albinotic . The above findings provided new insights into the molecular mechanism of albinism in bamboo.
PubMed: 38140417
DOI: 10.3390/plants12244090 -
Impaired Autophagic Clearance with a Gain-of-Function Variant of the Lysosomal Cl/H Exchanger ClC-7.Biomolecules Dec 2023ClC-7 is a ubiquitously expressed voltage-gated Cl/H exchanger that critically contributes to lysosomal ion homeostasis. Together with its β-subunit Ostm1, ClC-7...
ClC-7 is a ubiquitously expressed voltage-gated Cl/H exchanger that critically contributes to lysosomal ion homeostasis. Together with its β-subunit Ostm1, ClC-7 localizes to lysosomes and to the ruffled border of osteoclasts, where it supports the acidification of the resorption lacuna. Loss of ClC-7 or Ostm1 leads to osteopetrosis accompanied by accumulation of storage material in lysosomes and neurodegeneration. Interestingly, not all osteopetrosis-causing mutations from patients are associated with a loss of ion transport. Some rather result in an acceleration of voltage-dependent ClC-7 activation. Recently, a gain-of-function variant, ClC-7, that yields larger ion currents upon heterologous expression, was identified in two patients with neurodegeneration, organomegaly and albinism. However, neither the patients nor a mouse model that carried the equivalent mutation developed osteopetrosis, although expression of ClC-7 induced the formation of enlarged intracellular vacuoles. Here, we investigated how, in transfected cells with mutant ClC-7, the substitution of this tyrosine impinged on the morphology and function of lysosomes. Combinations of the tyrosine mutation with mutations that either uncouple Cl from H counter-transport or strongly diminish overall ion currents were used to show that increased ClC-7 Cl/H exchange activity is required for the formation of enlarged vacuoles by membrane fusion. Degradation of endocytosed material was reduced in these compartments and resulted in an accumulation of lysosomal storage material. In cells expressing the ClC-7 gain-of-function mutant, autophagic clearance was largely impaired, resulting in a build-up of autophagic material.
Topics: Mice; Animals; Humans; Osteopetrosis; Gain of Function Mutation; Mutation; Lysosomes; Tyrosine; Chloride Channels
PubMed: 38136669
DOI: 10.3390/biom13121799 -
Children (Basel, Switzerland) Dec 2023(1) Background: The aim of the study was to describe refractive development from early childhood to adulthood in Danish patients with albinism and to evaluate the effect...
(1) Background: The aim of the study was to describe refractive development from early childhood to adulthood in Danish patients with albinism and to evaluate the effect of foveal developmental stage on refractive development; (2) Methods: Patients with a clinical diagnosis of ocular or oculocutaneous albinism were invited for a refractive evaluation and comprehensive phenotyping including macular optical coherence tomography (OCT) scans. Foveal hypoplasia was graded based on OCT from 0 (normal) to 4 (absence of any signs of foveal specialization). Medical files were reviewed for historical refractive values in individual patients; (3) Results: Hyperopia (spherical equivalent refraction (SEQ) of ≥+1 Diopter (D)) was common in both children (81.3%) and adults (67.1%). The lower prevalence of hyperopia in adults was predominantly explained by increasing astigmatism with age. Emmetropization (>2D change from before 3 years to adolescence) was seen in 22.2%. There was no influence on foveal hypoplasia grade on the degree of refractive errors throughout life; (4) Conclusions: We found that emmetropization was uncommon in Danish patients with albinism and that the degree of foveal developmental stage did not influence emmetropization or the distribution of refractive errors. High degrees of hyperopia and astigmatism were common. These results indicate that fear of impeding emmetropization should not refrain the clinician from providing adequate correction for refractive errors in young children with albinism.
PubMed: 38136112
DOI: 10.3390/children10121910