-
Natural Product Research Jun 2024The study explored DC. for mosquito larvicidal potential by performing bioactivity-guided chemical investigation of its root extract resulting in isolation of the known...
The study explored DC. for mosquito larvicidal potential by performing bioactivity-guided chemical investigation of its root extract resulting in isolation of the known bioactive metabolite glaucarubinone (). Mosquito larvicidal activity of glaucarubinone () against the three vector species viz. and was determined using a modified WHO 2005 protocol. It was observed that larvae were the most susceptible species with LC 13.88 ppm and LC 70.01 ppm followed by and at 24 h of exposure. The mode of action as observed microscopically is the lysis of midgut and thorax cells of the third instar larvae. The crystal structure of the glaucarubinone () is reported for the first time using X-ray crystallography. This phytochemical product has the potential to act as a green alternative to existing chemical-based insecticides for integrated vector management.
PubMed: 38940013
DOI: 10.1080/14786419.2024.2371569 -
Sheng Li Xue Bao : [Acta Physiologica... Jun 2024The incidence of diabetes mellitus is increasing, and the sleep quality of patients with diabetes mellitus is often affected. Baduanjin may act on biological rhythm of... (Review)
Review
The incidence of diabetes mellitus is increasing, and the sleep quality of patients with diabetes mellitus is often affected. Baduanjin may act on biological rhythm of the body, skeletal muscle glucose metabolism, skeletal muscle fibers and suprachiasmatic nucleus (SCN) by regulating the expression of Bmal1 gene, thus regulating the blood glucose level and circadian rhythm of patients with type 2 diabetes mellitus (T2DM) and improving their physiological functions. This article reviews the regulatory effect and mechanism of Baduanjin on Bmal1 gene expression in diabetes patients, and discusses the possibility of Baduanjin to improve the sleep quality of T2DM patients by regulating Bmal1 gene expression. This review can provide a new field for the clinical application of traditional Chinese Qigong Baduanjin, and provide a new scientific basis for exercise therapy of diabetes.
Topics: Humans; Diabetes Mellitus, Type 2; ARNTL Transcription Factors; Sleep Quality; Circadian Rhythm; Qigong; Drugs, Chinese Herbal
PubMed: 38939939
DOI: No ID Found -
JACS Au Jun 2024Reductive catalytic fractionation (RCF) is a promising method to extract and depolymerize lignin from biomass, and bench-scale studies have enabled considerable progress...
Reductive catalytic fractionation (RCF) is a promising method to extract and depolymerize lignin from biomass, and bench-scale studies have enabled considerable progress in the past decade. RCF experiments are typically conducted in pressurized batch reactors with volumes ranging between 50 and 1000 mL, limiting the throughput of these experiments to one to six reactions per day for an individual researcher. Here, we report a high-throughput RCF (HTP-RCF) method in which batch RCF reactions are conducted in 1 mL wells machined directly into Hastelloy reactor plates. The plate reactors can seal high pressures produced by organic solvents by vertically stacking multiple reactor plates, leading to a compact and modular system capable of performing 240 reactions per experiment. Using this setup, we screened solvent mixtures and catalyst loadings for hydrogen-free RCF using 50 mg poplar and 0.5 mL reaction solvent. The system of 1:1 isopropanol/methanol showed optimal monomer yields and selectivity to 4-propyl substituted monomers, and validation reactions using 75 mL batch reactors produced identical monomer yields. To accommodate the low material loadings, we then developed a workup procedure for parallel filtration, washing, and drying of samples and a H nuclear magnetic resonance spectroscopy method to measure the RCF oil yield without performing liquid-liquid extraction. As a demonstration of this experimental pipeline, 50 unique switchgrass samples were screened in RCF reactions in the HTP-RCF system, revealing a wide range of monomer yields (21-36%), S/G ratios (0.41-0.93), and oil yields (40-75%). These results were successfully validated by repeating RCF reactions in 75 mL batch reactors for a subset of samples. We anticipate that this approach can be used to rapidly screen substrates, catalysts, and reaction conditions in high-pressure batch reactions with higher throughput than standard batch reactors.
PubMed: 38938803
DOI: 10.1021/jacsau.4c00126 -
Scientifica 2024is well known for its medicinal properties. It has exhibited various pharmacological activities, such as antidiabetic, anti-inflammatory, and antimicrobial activities....
is well known for its medicinal properties. It has exhibited various pharmacological activities, such as antidiabetic, anti-inflammatory, and antimicrobial activities. Although this plant is used worldwide as a vegetable and medicinal ingredient in herbal medicines, its toxicity studies have not been conducted to date. This study attempts to understand its toxicity. The present study examined the activity of two enzymes, acetylcholinesterase and succinate dehydrogenase, as well as histopathological variations in the liver, intestine, and gills of zebrafish. The results of the acetylcholinesterase assay showed that the concentrations of 40 mg/L and 60 mg/L of the four extracts (leaf and fruit extracts of both varieties) exhibited increased enzyme activity. Interestingly, the leaves of the green fruit variety at a concentration of 60 mg/L showed the highest activity, with a value of 2.824 ± 0.0682 micromoles/min compared to the control value of 1.8347 ± 0.0046 micromoles/min. On the other hand, the succinate dehydrogenase assay revealed that the concentrations of 40 mg/L and 60 mg/L of the extracts decreased the enzyme activity. The highest inhibition was observed in the concentration of 60 mg/L of the leaves of the white-fruited variety and the green-fruited variety, with values of 1.884 ± 0.0482 micromoles/min compared to the control value of 2.747 ± 0.0046 micromoles/min. The studies on histopathological changes also demonstrated abnormalities in the brain, liver, intestine, and gills of zebrafish after the exposure to the extracts of . The severity of the damage varied from low to high concentraions. In general, this study sheds light on the safety profile of and highlights its potential toxicity in animal models. The findings suggest that more research is needed to fully understand the toxicity of this plant and its implications for human use.
PubMed: 38938544
DOI: 10.1155/2024/4689625 -
Open Veterinary Journal May 2024A fracture is considered a medical emergency leading to considerable complications.
BACKGROUND
A fracture is considered a medical emergency leading to considerable complications.
AIM
This study aimed to describe the accelerating action of Ag-NPs-FG on fracture healing in rabbits.
METHODS
Silver NPs (AgNPs) were reduced with fenugreek (FG), loaded into a starch gel base, and investigated for their morphology, size, and charge. Four equal groups were randomly formed of 40 adult male rabbits. A 3.5 mm diameter bone defect was created at the proximal metaphysis of the right tibia in each rabbit. Groups 1-4 were injected with placebo saline, AgNPs-FG, plain gel, and FG-gel at the bone defect zone, respectively. The healing was assessed for 8 weeks postoperatively based on the radiographic, bone turnover markers, and histopathological examinations.
RESULTS
The AgNPs-FG was obtained as a faint reddish color, spherical in shape, with an absorbance of 423 nm, a size of 118.0 ± 1.7 nm, and a surface charge of -7.8 ± 0.518 mV. The prepared AgNPs-FG hydrogel was clear, translucent, and homogenous. The pH values were 6.55-6.5 ± 0.2, the viscosity of 4,000 and 1,875 cPs, and spreadability of 1.6 ± 0.14 and 2.0 ± 0.15 for both FG and AgNPs-FG hydrogel, respectively. The radiographic union scale was significantly ( < 0.05) improved in group 2 with a significant ( < 0.05) increase in bone turnover markers was found in comparison to other treated groups. Histopathological examination revealed the formation of mature bone on the 28th postoperative day in groups 2 and 4.
CONCLUSION
Colloidal nano-formulation of AgNPs-FG loaded hydrogel could be a promising formulation to accelerate rabbits' tibial bone healing process.
Topics: Animals; Rabbits; Trigonella; Silver; Male; Metal Nanoparticles; Tibia; Fracture Healing; Plant Extracts
PubMed: 38938444
DOI: 10.5455/OVJ.2024.v14.i5.23 -
Open Veterinary Journal May 2024Diabetes mellitus (DM) is a long-term condition marked by high blood glucose levels caused by insulin resistance which will lead to complications of other diseases such...
BACKGROUND
Diabetes mellitus (DM) is a long-term condition marked by high blood glucose levels caused by insulin resistance which will lead to complications of other diseases such as dyslipidemia, which also affects the health of the liver and kidneys. Butterfly pea flower ( L.) has phenolic and flavonoid compounds which have the potential as herbal medicines for antidiabetics.
AIM
The purpose of this study is to examine the potential of butterfly pea flower extract (BPE) as an antidiabetic, anti-dyslipidemia, and renoprotection.
METHODS
test was performed on Sprague Dawley rats ( L.) induced by Streptozotocin-Nicotinamide and High Fat Diet-Propylthiouracil as models of DM and dyslipidemia, and BPE was administered orally (200, 400, and 800 mg/kg BW) for 28 days. glutathione peroxidase (GSH-Px), glutathione S-transferase (GST), tumor necrosis factor-α (TNF-α), nuclear factor-kappa beta (NF-kB), alkaline phosphatase (ALP), liver albumin levels, serum blood urea nitrogen (BUN), serum creatinine, and serum uric acid (UA), were measured by ELISA and colorimetry methods.
RESULTS
Treatment of BPE 800 mg/kg BW increased levels of GSH-Px, GST, albumin, and serum protein. BPE decreased TNF-α, NF-kB, and ALP. BPE also decreased BUN, serum CR, and serum UA.
CONCLUSION
BPE has the potential to be used as a drug alternative for the treatment of DM and dyslipidemia as well as a hepatoprotective and renoprotective agent.
Topics: Animals; Plant Extracts; Rats, Sprague-Dawley; Rats; Dyslipidemias; Male; Hypoglycemic Agents; Hypolipidemic Agents; Diabetes Mellitus, Experimental; Flowers
PubMed: 38938424
DOI: 10.5455/OVJ.2024.v14.i5.7 -
Open Veterinary Journal May 2024Oxygen deprivation (OD) is a critical condition that can lead to brain damage and even death. Current hypoxia management approaches are limited in effectiveness. (CA),...
BACKGROUND
Oxygen deprivation (OD) is a critical condition that can lead to brain damage and even death. Current hypoxia management approaches are limited in effectiveness. (CA), known for its neuroprotective properties, offers a potential alternative for OD treatment.
AIMS
This study aims to investigate the neuroprotective effects of CA on the expression of brain-derived neurotrophic factor (BDNF) and vesicular glutamate transporter 1 (VGLUT1) in zebrafish larvae under oxygen-deficient conditions.
METHODS
Zebrafish embryos were subjected to low oxygen levels (1.5 mg/l) 0-2 hours post-fertilization (hpf) until 3 days post-fertilization (dpf), simulating the early stages of OD. Subsequent treatment involved varying concentrations of CA (1.25-5 µg/ml) up to 9 days post-fertilization. The expression levels of BDNF and VGLUT1 were measured using PCR methods. Statistical analysis was conducted using a two-way analysis of variance to evaluate the impact of CA on the expression of BDNF and VGLUT1 in zebrafish larvae aged 3 and 9 dpf in oxygen-deprived conditions.
RESULTS
CA significantly influenced the expression of BDNF and VGLUT1 under OD ( < 0.001). An increase in BDNF expression ( < 0.001) and a decrease in VGLUT1 ( < 0.01) were observed in zebrafish larvae experiencing OD and treated with CA. There was no significant difference in BDNF and VGLUT1 expression across age variations in zebrafish larvae at 3 dpf and 9 dpf in the treatment groups ( > 0.05). CA concentration of 2.5 µg/ml effectively enhanced BDNF and reduced VGLUT1 in 3-9 dpf zebrafish larvae.
CONCLUSION
CA demonstrates potential as a neuroprotective agent, modulating increased BDNF expression and reduced VGLUT1 under OD conditions. These findings lay a foundation for further research in developing therapies for oxygen deficiency.
Topics: Animals; Zebrafish; Centella; Plant Extracts; Larva; Triterpenes; Brain-Derived Neurotrophic Factor; Neuroprotective Agents; Oxygen; Fish Diseases; Hypoxia
PubMed: 38938421
DOI: 10.5455/OVJ.2024.v14.i5.9 -
Immunity, Inflammation and Disease Jun 2024To explore the efficacy and potential mechanism of Fengshi Gutong capsule (FSGTC) in osteoarthritis (OA) inflammation.
OBJECTIVE
To explore the efficacy and potential mechanism of Fengshi Gutong capsule (FSGTC) in osteoarthritis (OA) inflammation.
METHODS
The impact of FSGTC on laboratory indicators of OA patients was explored using data mining technology and association rule analysis. Then, the OA cell model was constructed by inducing chondrocytes (CHs) with interleukin-1β (IL-1β). In the presence of FSGTC intervention, the regulatory mechanism of PACER/COX2/PGE2 in OA-CH viability and inflammatory responses was evaluated.
RESULTS
Retrospective data mining showed that FSGTC effectively reduced inflammation indexes (ESR, HCRP) of OA patients. Cell experiments showed that LncRNA PACER (PACER) silencing inhibited the proliferation activity of OA-CHs, increased the level of COX2 protein, elevated the levels of PGE2, TNF-α, and IL-1β, and decreased the levels of IL-4 and IL-10 (p < .01). On the contrary, FSGTC-containing serum reversed the effect of PACER silencing on OA-CHs (p < .01). After the addition of COX2 pathway inhibitor, the proliferation activity of OA-CHs was enhanced; the levels of PGE2, TNF-α, and IL-1β were decreased while the levels of IL-4 and IL-10 were increased (p < .01).
CONCLUSION
FSGTC inhibits IL-1β-induced inflammation in CHs and ameliorates OA by upregulating PACER and downregulating COX2/PGE2.
Topics: Chondrocytes; RNA, Long Noncoding; Humans; Interleukin-1beta; Cyclooxygenase 2; Dinoprostone; Osteoarthritis; Inflammation; Drugs, Chinese Herbal; Down-Regulation; Male; Female; Up-Regulation; Middle Aged
PubMed: 38938021
DOI: 10.1002/iid3.1334 -
Plant Disease Jun 2024During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas,...
During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas, USA and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Laurel, Maryland for pathogen identification and confirmatory testing. Ribo-depleted libraries for all four samples were prepared for high-throughput sequencing (HTS) analysis, using the RNA extracts of individual grapefruit samples. HTS yielded 13.6 to 22.8 million 75 bp paired-end raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (GenBank accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, a few Caulimoviridae and Retroviridae contigs were also identified in the libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. To know the association of chlorotic blotch symptoms with NeVM, 12 symptomatic and 4 non-symptomatic grapefruit samples were collected for testing (Supplementary Figure 1). A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´)/NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a detection assay. The results of the 671 bp amplicon sequencing showed that 13 (12+1) of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 87.63-92.25% nt identities with the nectarine isolates of NeVM (KT273411-13) and 78% with the Canadian prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived 2019 (TX4) and 2023 leaf tissue samples (LF1 and LF2) from La Feria, TX were selected for genetic analysis. The primer pair Marafi Gen-1F/NeVM-1R targeting the helicase domain of NeVM, successfully amplified the expected 671 bp product. The amplicon sequence of isolate TX4 shared 97.76% and 89.87% nt identities with isolates LF1 and LF2, respectively, while LF1 shared 90.76% nt identity with LF2. Sequence variation was observed for a 1906 bp overlapping amplicon obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´)/Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG3´), spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of TX4 shared 94 and 95% nt identities with LF2 and LF1, respectively, but only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91.08 to 92.29% nt identity with American prunus isolates (KT273411-13) and 75% nt identity with Canadian isolate (MZ291915). Three sequences of 671 bp and 1906 bp amplicons were deposited in GenBank under accession numbers PP767656-61. From the regulatory point of view, NeVM fails to satisfy the criteria to be considered as potential quarantine pests for the European Union because of the absence of information on its biology, distribution, and economic impact (Bragard et al., 2019). However, this report expands the natural host range of NeVM to include grapefruit. From an epidemiological standpoint, more data on host range, varietal susceptibility, and genetic variability among citrus and prunus isolates are needed to conclude the association of NeVM infection with symptoms development.
PubMed: 38937932
DOI: 10.1094/PDIS-05-24-1024-PDN -
BMC Plant Biology Jun 2024Betalains are reddish and yellow pigments that accumulate in a few plant species of the order Caryophyllales. These pigments have antioxidant and medicinal properties...
BACKGROUND
Betalains are reddish and yellow pigments that accumulate in a few plant species of the order Caryophyllales. These pigments have antioxidant and medicinal properties and can be used as functional foods. They also enhance resistance to stress or disease in crops. Several plant species belonging to other orders have been genetically engineered to express betalain pigments. Betalains can also be used for flower color modification in ornamental plants, as they confer vivid colors, like red and yellow. To date, betalain engineering to modify the color of Torenia fournieri-or wishbone flower-a popular ornamental plant, has not been attempted.
RESULTS
We report the production of purple-reddish-flowered torenia plants from the purple torenia cultivar "Crown Violet." Three betalain-biosynthetic genes encoding CYP76AD1, dihydroxyphenylalanine (DOPA) 4,5-dioxygenase (DOD), and cyclo-DOPA 5-O-glucosyltransferase (5GT) were constitutively ectopically expressed under the cauliflower mosaic virus (CaMV) 35S promoter, and their expression was confirmed by quantitative real-time PCR (qRT-PCR) analysis. The color traits, measured by spectrophotometric colorimeter and spectral absorbance of fresh petal extracts, revealed a successful flower color modification from purple to reddish. Red pigmentation was also observed in whole plants. LC-DAD-MS and HPLC analyses confirmed that the additional accumulated pigments were betacyanins-mainly betanin (betanidin 5-O-glucoside) and, to a lesser extent, isobetanin (isobetanidin 5-O-glucoside). The five endogenous anthocyanins in torenia flower petals were also detected.
CONCLUSIONS
This study demonstrates the possibility of foreign betacyanin accumulation in addition to native pigments in torenia, a popular garden bedding plant. To our knowledge, this is the first report presenting engineered expression of betalain pigments in the family Linderniaceae. Genetic engineering of betalains would be valuable in increasing the flower color variation in future breeding programs for torenia.
Topics: Betacyanins; Flowers; Genetic Engineering; Pigmentation; Caryophyllales; Plants, Genetically Modified; Betalains
PubMed: 38937670
DOI: 10.1186/s12870-024-05284-1