-
Immunity, Inflammation and Disease Jun 2024To explore the efficacy and potential mechanism of Fengshi Gutong capsule (FSGTC) in osteoarthritis (OA) inflammation.
OBJECTIVE
To explore the efficacy and potential mechanism of Fengshi Gutong capsule (FSGTC) in osteoarthritis (OA) inflammation.
METHODS
The impact of FSGTC on laboratory indicators of OA patients was explored using data mining technology and association rule analysis. Then, the OA cell model was constructed by inducing chondrocytes (CHs) with interleukin-1β (IL-1β). In the presence of FSGTC intervention, the regulatory mechanism of PACER/COX2/PGE2 in OA-CH viability and inflammatory responses was evaluated.
RESULTS
Retrospective data mining showed that FSGTC effectively reduced inflammation indexes (ESR, HCRP) of OA patients. Cell experiments showed that LncRNA PACER (PACER) silencing inhibited the proliferation activity of OA-CHs, increased the level of COX2 protein, elevated the levels of PGE2, TNF-α, and IL-1β, and decreased the levels of IL-4 and IL-10 (p < .01). On the contrary, FSGTC-containing serum reversed the effect of PACER silencing on OA-CHs (p < .01). After the addition of COX2 pathway inhibitor, the proliferation activity of OA-CHs was enhanced; the levels of PGE2, TNF-α, and IL-1β were decreased while the levels of IL-4 and IL-10 were increased (p < .01).
CONCLUSION
FSGTC inhibits IL-1β-induced inflammation in CHs and ameliorates OA by upregulating PACER and downregulating COX2/PGE2.
Topics: Chondrocytes; RNA, Long Noncoding; Humans; Interleukin-1beta; Cyclooxygenase 2; Dinoprostone; Osteoarthritis; Inflammation; Drugs, Chinese Herbal; Down-Regulation; Male; Female; Up-Regulation; Middle Aged
PubMed: 38938021
DOI: 10.1002/iid3.1334 -
Plant Disease Jun 2024During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas,...
During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas, USA and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Laurel, Maryland for pathogen identification and confirmatory testing. Ribo-depleted libraries for all four samples were prepared for high-throughput sequencing (HTS) analysis, using the RNA extracts of individual grapefruit samples. HTS yielded 13.6 to 22.8 million 75 bp paired-end raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (GenBank accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, a few Caulimoviridae and Retroviridae contigs were also identified in the libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. To know the association of chlorotic blotch symptoms with NeVM, 12 symptomatic and 4 non-symptomatic grapefruit samples were collected for testing (Supplementary Figure 1). A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´)/NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a detection assay. The results of the 671 bp amplicon sequencing showed that 13 (12+1) of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 87.63-92.25% nt identities with the nectarine isolates of NeVM (KT273411-13) and 78% with the Canadian prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived 2019 (TX4) and 2023 leaf tissue samples (LF1 and LF2) from La Feria, TX were selected for genetic analysis. The primer pair Marafi Gen-1F/NeVM-1R targeting the helicase domain of NeVM, successfully amplified the expected 671 bp product. The amplicon sequence of isolate TX4 shared 97.76% and 89.87% nt identities with isolates LF1 and LF2, respectively, while LF1 shared 90.76% nt identity with LF2. Sequence variation was observed for a 1906 bp overlapping amplicon obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´)/Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG3´), spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of TX4 shared 94 and 95% nt identities with LF2 and LF1, respectively, but only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91.08 to 92.29% nt identity with American prunus isolates (KT273411-13) and 75% nt identity with Canadian isolate (MZ291915). Three sequences of 671 bp and 1906 bp amplicons were deposited in GenBank under accession numbers PP767656-61. From the regulatory point of view, NeVM fails to satisfy the criteria to be considered as potential quarantine pests for the European Union because of the absence of information on its biology, distribution, and economic impact (Bragard et al., 2019). However, this report expands the natural host range of NeVM to include grapefruit. From an epidemiological standpoint, more data on host range, varietal susceptibility, and genetic variability among citrus and prunus isolates are needed to conclude the association of NeVM infection with symptoms development.
PubMed: 38937932
DOI: 10.1094/PDIS-05-24-1024-PDN -
BMC Plant Biology Jun 2024Betalains are reddish and yellow pigments that accumulate in a few plant species of the order Caryophyllales. These pigments have antioxidant and medicinal properties...
BACKGROUND
Betalains are reddish and yellow pigments that accumulate in a few plant species of the order Caryophyllales. These pigments have antioxidant and medicinal properties and can be used as functional foods. They also enhance resistance to stress or disease in crops. Several plant species belonging to other orders have been genetically engineered to express betalain pigments. Betalains can also be used for flower color modification in ornamental plants, as they confer vivid colors, like red and yellow. To date, betalain engineering to modify the color of Torenia fournieri-or wishbone flower-a popular ornamental plant, has not been attempted.
RESULTS
We report the production of purple-reddish-flowered torenia plants from the purple torenia cultivar "Crown Violet." Three betalain-biosynthetic genes encoding CYP76AD1, dihydroxyphenylalanine (DOPA) 4,5-dioxygenase (DOD), and cyclo-DOPA 5-O-glucosyltransferase (5GT) were constitutively ectopically expressed under the cauliflower mosaic virus (CaMV) 35S promoter, and their expression was confirmed by quantitative real-time PCR (qRT-PCR) analysis. The color traits, measured by spectrophotometric colorimeter and spectral absorbance of fresh petal extracts, revealed a successful flower color modification from purple to reddish. Red pigmentation was also observed in whole plants. LC-DAD-MS and HPLC analyses confirmed that the additional accumulated pigments were betacyanins-mainly betanin (betanidin 5-O-glucoside) and, to a lesser extent, isobetanin (isobetanidin 5-O-glucoside). The five endogenous anthocyanins in torenia flower petals were also detected.
CONCLUSIONS
This study demonstrates the possibility of foreign betacyanin accumulation in addition to native pigments in torenia, a popular garden bedding plant. To our knowledge, this is the first report presenting engineered expression of betalain pigments in the family Linderniaceae. Genetic engineering of betalains would be valuable in increasing the flower color variation in future breeding programs for torenia.
Topics: Betacyanins; Flowers; Genetic Engineering; Pigmentation; Caryophyllales; Plants, Genetically Modified; Betalains
PubMed: 38937670
DOI: 10.1186/s12870-024-05284-1 -
In Vivo (Athens, Greece) 2024This study examined the effects of tocotrienols (TT) in conjunction with statin on glucose homeostasis, bone microstructure, gut microbiome, and systemic and liver...
BACKGROUND/AIM
This study examined the effects of tocotrienols (TT) in conjunction with statin on glucose homeostasis, bone microstructure, gut microbiome, and systemic and liver inflammatory markers in obese C57BL/6J mice.
MATERIALS AND METHODS
Forty male C57BL/6J mice were fed a high-fat diet (HFD) and assigned into four groups in a 2 (no statin vs. 120 mg statin/kg diet)×2 (no TT vs. 400 mg TT/kg diet) factorial design for 14 weeks.
RESULTS
Statin and TT improved glucose tolerance only when each was given alone, and only statin supplementation decreased insulin resistance. Consistently, only statin supplementation decreased serum insulin levels and HOMA-IR. Pancreatic insulin was also increased with statin treatment. Statin and TT, alone or in combination, reduced the levels of serum IL-6, but only TT attenuated the increased serum leptin levels induced by a HFD. Statin supplementation increased bone area/total area and connectivity density at LV-4, while TT supplementation increased bone area/total area and trabecular number, but decreased trabecular separation at the distal femur. Statin supplementation, but not TT, reduced hepatic inflammatory cytokine gene expression. Neither TT supplementation nor statin supplementation statistically altered microbiome species evenness or richness. However, they altered the relative abundance of certain microbiome species. Most notably, both TT and statin supplementation increased the relative abundance of Lachnospiraceae UCG-006.
CONCLUSION
TT and statin collectively benefit bone microstructure, glucose homeostasis, and microbial ecology in obese mice. Such changes may be, in part, associated with suppression of inflammation in the host.
Topics: Animals; Gastrointestinal Microbiome; Tocotrienols; Mice; Homeostasis; Obesity; Male; Dietary Supplements; Bone and Bones; Hydroxymethylglutaryl-CoA Reductase Inhibitors; Diet, High-Fat; Bixaceae; Mice, Obese; Plant Extracts; Glucose; Mice, Inbred C57BL; Insulin Resistance; Blood Glucose; Disease Models, Animal; Liver; Biomarkers; Carotenoids
PubMed: 38936927
DOI: 10.21873/invivo.13606 -
In Vivo (Athens, Greece) 2024Dermal papilla (DP) stem cells are known for their remarkable regenerative capacity, making them a valuable model for assessing the effects of natural products on...
BACKGROUND/AIM
Dermal papilla (DP) stem cells are known for their remarkable regenerative capacity, making them a valuable model for assessing the effects of natural products on cellular processes, including stemness, and autophagy.
MATERIALS AND METHODS
Autophagy and stemness characteristics were assessed using real-time RT-PCR to analyze mRNA levels, along with immunofluorescence and western blot techniques for protein level evaluation.
RESULTS
Butterfly Pea, Emblica Fruits, Kaffir Lime, and Thunbergia Laurifolia extracts induced autophagy in DP cells. Kaffir Lime-treated cells exhibited increase in the OCT4, NANOG, and SOX2 mRNA (6-, 5, and 5.5-fold, respectively), and protein levels (4-, 3-, and 1.5-fold, respectively). All extracts activated the survival protein kinase B (Akt) in DP cells.
CONCLUSION
Natural products are a promising source for promoting hair growth by rejuvenating hair stem cells.
Topics: Autophagy; Humans; Stem Cells; Biological Products; Plant Extracts; Hair Follicle; Octamer Transcription Factor-3; Nanog Homeobox Protein; SOXB1 Transcription Factors; Proto-Oncogene Proteins c-akt; Dermis; Cell Differentiation
PubMed: 38936924
DOI: 10.21873/invivo.13627 -
In Vivo (Athens, Greece) 2024The leaves of Laurus nobilis have been used for culinary purposes for many years and have recently been shown to have beneficial effects on human health by altering...
BACKGROUND/AIM
The leaves of Laurus nobilis have been used for culinary purposes for many years and have recently been shown to have beneficial effects on human health by altering microbiota composition. However, the effects of L. nobilis on the diversity of microbiomes in the oral cavity and gut remain unknown. Therefore, in this study, we examined the effects of an extract of L. nobilis on the diversity of microbiomes in the oral cavity and gut in mice.
MATERIALS AND METHODS
C57BL/6J mice were randomly divided into two groups and fed a standard diet (SD) and a standard diet containing 5% LAURESH, a laurel extract (SDL). After 10 weeks, oral swabs and fecal samples were collected. The bacterial DNA extracted from the oral swabs and feces was used for microbiota analysis using 16S rRNA sequencing. The sequencing data were analyzed using the Quantitative Insights into Microbial Ecology 2 in the DADA2 pipeline and 16S rRNA database.
RESULTS
The α-diversity of the oral microbiome was significantly greater in the SDL group than in the SD group. The β-diversity of the oral microbiome was also significantly different between the groups. Moreover, the taxonomic abundance analysis showed that five bacteria in the gut were significantly different among the groups. Furthermore, the SDL diet increased the abundance of beneficial gut bacteria, such as Akkermansia sp.
CONCLUSION
Increased diversity of the oral microbiome and proportion of Akkermansia sp. in the gut microbiome induced by L. nobilis consumption may benefit oral and gut health.
Topics: Animals; Gastrointestinal Microbiome; Plant Leaves; Mice; Plant Extracts; Laurus; RNA, Ribosomal, 16S; Mouth; Biodiversity; Feces; Bacteria; Male; Mice, Inbred C57BL
PubMed: 38936916
DOI: 10.21873/invivo.13626 -
Fitoterapia Jun 2024Buxus plants have been used in traditional medicine for a very long time. The Buxus genus has been used to cure a variety of illnesses. (Review)
Review
BACKGROUND
Buxus plants have been used in traditional medicine for a very long time. The Buxus genus has been used to cure a variety of illnesses.
OBJECTIVE
This review aimed to provide a literature review on the genus Buxus including its biological and phytochemical properties.
MATERIALS AND METHODS
The current study was conducted using several scientific databases. Correct plant names were verified from plantlist.org. The results of this search were interpreted, analyzed, and documented based on the obtained bibliographic information.
RESULTS
Within all the species of the family Buxaceae, 5 species of the genus Buxus are reported to be antibacterial, 3 species have been found to be antioxidant, 5 species are cytotoxic, 1 species is anti-inflammatory, 1 species is antidiabetic, and 4 species are antifungal. Alkaloids, terpenoids, tannins, flavonoids, peptides, and phenolic compounds are the main chemical components of this genus. The study of >11 Buxuss pecies has identified >201 compounds. Pharmacological research has demonstrated that crude extracts and some pure compounds obtained from Buxus have several pharmacological activities such as antibacterial, antioxidant, cytotoxic, anti-inflammatory, antidiabetic, and antifungal. Based on the study of the phytochemistry of Buxus species, it was concluded that all the studied plants have active compounds, among which 55 molecules showed interesting activities.
CONCLUSIONS
The numerous traditional uses of Buxus species have been supported by several studies. Before Buxus plants can be fully employed clinically, further research is necessary.
PubMed: 38936673
DOI: 10.1016/j.fitote.2024.106081 -
Bioorganic Chemistry Jun 2024The antifungal bioactivity potential of the organic extract of silk tree (Albizia kalkora) was investigated in the current study. The crude extracts of A. kalkora and...
The antifungal bioactivity potential of the organic extract of silk tree (Albizia kalkora) was investigated in the current study. The crude extracts of A. kalkora and methanol, n-hexane, chloroform, and ethyl acetate fractions were prepared. The antifungal activity of obtained fractions of A. kalkora was studied at different concentrations ranging from 0.39-50 µg/mL. Dimethyl sulfoxide (DMSO) was taken as a toxicity control, whereas thiophanate methyl (TM) as a positive control. All the fractions significantly reduced the FOL growth (methanolic: 9.49-94.93 %, n-hexane: 11.12-100 %, chloroform: 20.96-91.41 %, and ethyl acetate: 18.75-96.70 %). The n-hexane fraction showed 6.25 µg/mL MIC as compared to TM with 64 µg/mL MIC. The non-polar (n-hexane) fraction showed maximum antifungal bioactivity against FOL in comparison with chloroform, methanol, and ethyl acetate fractions. GC/MS analysis exhibited that the n-hexane fraction contained hexadecanoic acid, 9,12,15-octadecatrienoic acid, 9,12-octadecadienoic acid, bis(2-ethylhexyl) phthalate, methyl stearate, and [1,2,4]triazolo[1,5-a]pyrimidine-6-carboxylic acid. The results of in vitro antifungal inhibition were further reinforced by molecular docking analysis. Five virulence proteins of FOL i.e., pH-responsive PacC transcription factor (PACC), MeaB, TOR; target of rapamycin (FMK1), Signal transducing MAP kinase kinase (STE-STE7), and High Osmolarity Glycerol 1(HOG1) were docked with identified phytocompounds in the n-hexane fraction by GC/MS analysis. MEAB showed maximum binding affinities with zinnimide (-12.03 kcal/mol), HOG1 and FMK1with α-Tocospiro-B (-11.51 kcal/mol) and (-10.55 kcal/mol) respectively, STE-STE7 with docosanoic acid (-11.31 kcal/mol), and PACC with heptadecanoic acid (-9.88 kcal/mol) respectively with strong hydrophobic or hydrophilic interactions with active pocket residues. In conclusion, the n-hexane fraction of the A. kalkora can be used to manage FOL.
PubMed: 38936050
DOI: 10.1016/j.bioorg.2024.107561 -
Journal of Medicinal Food Jun 2024Malaria impedes the ability of primary cells of the immune system to generate an efficacious inflammatory and immune response. Black seed () is a core dietary supplement...
Malaria impedes the ability of primary cells of the immune system to generate an efficacious inflammatory and immune response. Black seed () is a core dietary supplement and food additive in folklore. This study investigated the antioxidant, immunomodulatory, and anti-inflammatory effects of cookies in -infected mice. Aqueous extract of black seed was prepared, and the total phenol and flavonoid contents were determined. The mice were infected with standard inoculum of the strain NK65 . The mice weight and behavioral changes were observed. The mice were fed with the cookies (2.5%, 5%, and 10%) and 10 mg/kg chloroquine for 5 consecutive days after the infection was established. The reactive oxygen species (ROS), malondialdehyde (MDA), superoxide dismutase, catalase, and hematological parameters (red cell indices, leukocytes, and its differentials) in the infected mice were determined. The inflammatory mediators, C-reactive protein (CRP), and myeloperoxidase (MPO) were also assayed. The result revealed that black seed had a total phenol content of 18.73 mgGAE/g and total flavonoid content of 0.36 mgQUE/g. The infected mice treated with cookies showed significantly decreased parasitaemia, MDA, and ROS levels. Furthermore, the results showed significant suppression in proinflammatory mediators (CRP and MPO) levels and enhanced antioxidant status of infected mice treated with . The study suggests that could function as nutraceuticals in the management of infection associated with inflammatory and immunomodulatory disorders.
Topics: Animals; Plasmodium berghei; Malaria; Oxidative Stress; Mice; Nigella sativa; Seeds; Plant Extracts; Male; Antioxidants; Disease Models, Animal; Reactive Oxygen Species; Malondialdehyde; Inflammation; Anti-Inflammatory Agents; Food, Fortified; C-Reactive Protein; Superoxide Dismutase; Humans; Flavonoids; Peroxidase
PubMed: 38935918
DOI: 10.1089/jmf.2023.0181 -
Journal of Agricultural and Food... Jun 2024A study targeting novel antifungal metabolites identified potent antifungal activity against key plant pathogens in acetone extracts of sp. strain CA-296093....
A study targeting novel antifungal metabolites identified potent antifungal activity against key plant pathogens in acetone extracts of sp. strain CA-296093. Feature-based molecular networking revealed the presence in this extract of antimycin-related compounds, leading to the isolation of four new compounds: escuzarmycins A-D (-). Extensive structural elucidation, employing 1D and 2D NMR, high-resolution mass spectrometry, Marfey's analysis, and NOESY correlations, confirmed their structures. The bioactivity of these compounds was tested against six fungal phytopathogens, and compounds and demonstrated strong efficacy, particularly against , with compound exhibiting the highest potency (EC: 11 nM). Both compounds also displayed significant antifungal activity against and , with compound proving to be the most potent. Despite moderate cytotoxicity against the human cancer cell line HepG2, compounds and emerge as promising fungicides for combating blotch, anthracnose, and gray mold.
PubMed: 38935555
DOI: 10.1021/acs.jafc.4c01303