-
Plant Disease Jun 2024During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas,...
During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas, USA and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Laurel, Maryland for pathogen identification and confirmatory testing. Ribo-depleted libraries for all four samples were prepared for high-throughput sequencing (HTS) analysis, using the RNA extracts of individual grapefruit samples. HTS yielded 13.6 to 22.8 million 75 bp paired-end raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (GenBank accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, a few Caulimoviridae and Retroviridae contigs were also identified in the libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. To know the association of chlorotic blotch symptoms with NeVM, 12 symptomatic and 4 non-symptomatic grapefruit samples were collected for testing (Supplementary Figure 1). A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´)/NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a detection assay. The results of the 671 bp amplicon sequencing showed that 13 (12+1) of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 87.63-92.25% nt identities with the nectarine isolates of NeVM (KT273411-13) and 78% with the Canadian prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived 2019 (TX4) and 2023 leaf tissue samples (LF1 and LF2) from La Feria, TX were selected for genetic analysis. The primer pair Marafi Gen-1F/NeVM-1R targeting the helicase domain of NeVM, successfully amplified the expected 671 bp product. The amplicon sequence of isolate TX4 shared 97.76% and 89.87% nt identities with isolates LF1 and LF2, respectively, while LF1 shared 90.76% nt identity with LF2. Sequence variation was observed for a 1906 bp overlapping amplicon obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´)/Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG3´), spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of TX4 shared 94 and 95% nt identities with LF2 and LF1, respectively, but only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91.08 to 92.29% nt identity with American prunus isolates (KT273411-13) and 75% nt identity with Canadian isolate (MZ291915). Three sequences of 671 bp and 1906 bp amplicons were deposited in GenBank under accession numbers PP767656-61. From the regulatory point of view, NeVM fails to satisfy the criteria to be considered as potential quarantine pests for the European Union because of the absence of information on its biology, distribution, and economic impact (Bragard et al., 2019). However, this report expands the natural host range of NeVM to include grapefruit. From an epidemiological standpoint, more data on host range, varietal susceptibility, and genetic variability among citrus and prunus isolates are needed to conclude the association of NeVM infection with symptoms development.
PubMed: 38937932
DOI: 10.1094/PDIS-05-24-1024-PDN -
Virulence Dec 2024The implementation of pretreatment drug-resistance (PDR) surveillance among people living with HIV-1 (PLWH) is a top priority in countries using efavirenz...
The implementation of pretreatment drug-resistance (PDR) surveillance among people living with HIV-1 (PLWH) is a top priority in countries using efavirenz (EFV)/nevirapine (NVP) for first-line ART. In this study, we assessed the prevalence of PDR among PLWH in Shanghai, China during 2017-2021, and to reveal PDR transmission between Shanghai and other regions of China. A total of 5050 PLWH not on ART during 2017-2021 were included. Partial HIV-1 sequences were amplified, sequenced, and analysed for drug-resistance mutations (DRMs). Besides, transmission network of PDR variants was inferred using HIV-TRACE. The overall prevalence of PDR was 4.8% (242/5050; 95% CI, 4.2-5.4). Prevalence of NNRTI-associated PDR was 3.9% (95% CI, 3.4-4.5), higher than those of NRTI-associated (0.8%; 95% CI, 0.5-1.1) and PI-associated PDR (0.9%; 95% CI, 0.6-1.2). High prevalence of PDR (especially high-level resistance) to EFV (132/5050, 2.6%) and NVP (137/5050, 2.7%) were found. CRF01_AE (46.0%) was the predominant HIV-1 genotype with any DRMs, followed by CRF55_01B (21.0%), and CRF07_BC (15.1%). Two NRTI-associated (S68G/N/R and T215A/N/S/Y), five NNRTI-associated (V179D/E/T/L, K103N/R/S/T, E138A/G/K, V106M/I/A and Y181C/I) and two PI-associated mutations (M46I/L/V and Q58E) were the most common observed DRMs in PDR patients in Shanghai. The vast majority of S68G occurred in CRF01_AE (45%). M46I/L/V and Q58E showed a relatively high prevalence in CRF01_AE (4.1%) and CRF07_BC (12.6%). Transmission network analyses demonstrated cross-regional transmission links of PDR variants between Shanghai and other regions of China, which was mainly driven by the potential low-level DRM V179D/E. These results provide crucial information for clinical decision making of first-line ART in PLWH with PDR.
Topics: Humans; China; HIV-1; HIV Infections; Male; Drug Resistance, Viral; Female; Prevalence; Adult; Middle Aged; Anti-HIV Agents; Mutation; Young Adult; Cyclopropanes; Alkynes; Benzoxazines; Adolescent; Genotype; Nevirapine; Aged
PubMed: 38934465
DOI: 10.1080/21505594.2024.2373105 -
Viruses Jun 2024The envelope glycoprotein (Env) of retroviruses, such as the Feline leukemia virus (FeLV), is the main target of neutralizing humoral response, and therefore, a...
The envelope glycoprotein (Env) of retroviruses, such as the Feline leukemia virus (FeLV), is the main target of neutralizing humoral response, and therefore, a promising vaccine candidate, despite its reported poor immunogenicity. The incorporation of mutations that stabilize analogous proteins from other viruses in their prefusion conformation (e.g., HIV Env, SARS-CoV-2 S, or RSV F glycoproteins) has improved their capability to induce neutralizing protective immune responses. Therefore, we have stabilized the FeLV Env protein following a strategy based on the incorporation of a disulfide bond and an Ile/Pro mutation (SOSIP) previously used to generate soluble HIV Env trimers. We have characterized this SOSIP-FeLV Env in its soluble form and as a transmembrane protein present at high density on the surface of FeLV Gag-based VLPs. Furthermore, we have tested its immunogenicity in DNA-immunization assays in C57BL/6 mice. Low anti-FeLV Env responses were detected in SOSIP-FeLV soluble protein-immunized animals; however, unexpectedly no responses were detected in the animals immunized with SOSIP-FeLV Gag-based VLPs. In contrast, high humoral response against FeLV Gag was observed in the animals immunized with control Gag VLPs lacking SOSIP-FeLV Env, while this response was significantly impaired when the VLPs incorporated SOSIP-FeLV Env. Our data suggest that FeLV Env can be stabilized as a soluble protein and can be expressed in high-density VLPs. However, when formulated as a DNA vaccine, SOSIP-FeLV Env remains poorly immunogenic, a limitation that must be overcome to develop an effective FeLV vaccine.
Topics: Animals; Mice; Antibodies, Viral; Antibodies, Neutralizing; Mice, Inbred C57BL; Viral Envelope Proteins; Leukemia Virus, Feline; Gene Products, gag; Female; Vaccines, Virus-Like Particle; Humans; Cats; Viral Vaccines; Immunogenicity, Vaccine
PubMed: 38932278
DOI: 10.3390/v16060987 -
Viruses Jun 2024Viral integration within the host genome plays a pivotal role in carcinogenesis. Various disruptive mechanisms are involved, leading to genomic instability, mutations,...
Viral integration within the host genome plays a pivotal role in carcinogenesis. Various disruptive mechanisms are involved, leading to genomic instability, mutations, and DNA damage. With next-generation sequencing (NGS), we can now precisely identify viral and host genomic breakpoints and chimeric sequences, which are useful for integration site analysis. In this study, we evaluated a commercial hybrid capture NGS panel specifically designed for detecting three key viruses: HPV, HBV, and HIV-1. We also tested workflows for Viral Hybrid Capture (VHC) and Viral Integration Site (VIS) analysis, leveraging customized viral databases in CLC Microbial Genomics. By analyzing sequenced data from virally infected cancer cell lines (including SiHa, HeLa, CaSki, C-33A, DoTc2, 2A3, SCC154 for HPV; 3B2, SNU-182 for HBV; and ACH-2 for HIV-1), we precisely pinpointed viral integration sites. The workflow also highlighted disrupted and neighboring human genes that may play a crucial role in tumor development. Our results included informative virus-host read mappings, genomic breakpoints, and integration circular plots. These visual representations enhance our understanding of the integration process. In conclusion, our seamless end-to-end workflow bridges the gap in understanding viral contributions to cancer development, paving the way for improved diagnostics and treatment strategies.
Topics: Humans; Virus Integration; Hepatitis B virus; HIV-1; High-Throughput Nucleotide Sequencing; Workflow; Carcinogenesis; Genomics; Cell Line, Tumor; Papillomaviridae
PubMed: 38932267
DOI: 10.3390/v16060975 -
Viruses Jun 2024Understanding the underlying mechanisms of HIV pathogenesis is critical for designing successful HIV vaccines and cure strategies. However, achieving this goal is... (Review)
Review
Making a Monkey out of Human Immunodeficiency Virus/Simian Immunodeficiency Virus Pathogenesis: Immune Cell Depletion Experiments as a Tool to Understand the Immune Correlates of Protection and Pathogenicity in HIV Infection.
Understanding the underlying mechanisms of HIV pathogenesis is critical for designing successful HIV vaccines and cure strategies. However, achieving this goal is complicated by the virus's direct interactions with immune cells, the induction of persistent reservoirs in the immune system cells, and multiple strategies developed by the virus for immune evasion. Meanwhile, HIV and SIV infections induce a pandysfunction of the immune cell populations, making it difficult to untangle the various concurrent mechanisms of HIV pathogenesis. Over the years, one of the most successful approaches for dissecting the immune correlates of protection in HIV/SIV infection has been the in vivo depletion of various immune cell populations and assessment of the impact of these depletions on the outcome of infection in non-human primate models. Here, we present a detailed analysis of the strategies and results of manipulating SIV pathogenesis through in vivo depletions of key immune cells populations. Although each of these methods has its limitations, they have all contributed to our understanding of key pathogenic pathways in HIV/SIV infection.
Topics: Simian Immunodeficiency Virus; Animals; HIV Infections; Simian Acquired Immunodeficiency Syndrome; Humans; HIV; Disease Models, Animal; Haplorhini; Lymphocyte Depletion
PubMed: 38932264
DOI: 10.3390/v16060972 -
Viruses Jun 2024The human immunodeficiency virus type-1 epidemic in Pakistan has significantly increased over the last two decades. In Karachi, Pakistan, there is a lack of updated...
The human immunodeficiency virus type-1 epidemic in Pakistan has significantly increased over the last two decades. In Karachi, Pakistan, there is a lack of updated information on the complexity of HIV-1 genetic diversity and the burden of drug resistance mutations (DRMs) that can contribute to ART failure and poor treatment outcomes. This study aimed to determine HIV-1 genetic diversity and identify drug-resistance mutations among people living with HIV in Karachi. A total of 364 HIV-positive individuals, with a median age of 36 years, were enrolled in the study. The HIV-1 partial gene was successfully sequenced from 268 individuals. The sequences were used to generate phylogenetic trees to determine clade diversity and also to assess the burden of DRMs. Based on the partial sequences, 13 distinct HIV-1 subtypes and recombinant forms were identified. Subtype A1 was the most common clade (40%), followed by CRF02_AG (33.2%). Acquired DRMs were found in 30.6% of the ART-experienced patients, of whom 70.7%, 20.7%, and 8.5% were associated with resistance to NNRTIs, NRTIs, and PIs, respectively. Transmitted DRMs were found in 5.6% of the ART-naïve patients, of whom 93% were associated with resistance against NNRTIs and 7% to PIs. The high prevalence of DRMs in ART-experienced patients poses significant challenges to the long-term benefits and sustainability of the ART program. This study emphasizes the importance of continuous HIV molecular epidemiology and drug resistance surveillance to support evidence-based HIV prevention, precise ART, and targeted AIDS care.
Topics: Humans; HIV-1; Pakistan; HIV Infections; Drug Resistance, Viral; Adult; Male; Female; Genetic Variation; Mutation; Phylogeny; Anti-HIV Agents; Middle Aged; Young Adult; Genotype; Adolescent
PubMed: 38932254
DOI: 10.3390/v16060962 -
Viruses Jun 2024Type I interferons (IFN-Is) are pivotal in innate immunity against human immunodeficiency virus I (HIV-1) by eliciting the expression of IFN-stimulated genes (ISGs),... (Review)
Review
Type I interferons (IFN-Is) are pivotal in innate immunity against human immunodeficiency virus I (HIV-1) by eliciting the expression of IFN-stimulated genes (ISGs), which encompass potent host restriction factors. While ISGs restrict the viral replication within the host cell by targeting various stages of the viral life cycle, the lesser-known IFN-repressed genes (IRepGs), including RNA-binding proteins (RBPs), affect the viral replication by altering the expression of the host dependency factors that are essential for efficient HIV-1 gene expression. Both the host restriction and dependency factors determine the viral replication efficiency; however, the understanding of the IRepGs implicated in HIV-1 infection remains greatly limited at present. This review provides a comprehensive overview of the current understanding regarding the impact of the RNA-binding protein families, specifically the two families of splicing-associated proteins SRSF and hnRNP, on HIV-1 gene expression and viral replication. Since the recent findings show specifically that SRSF1 and hnRNP A0 are regulated by IFN-I in various cell lines and primary cells, including intestinal lamina propria mononuclear cells (LPMCs) and peripheral blood mononuclear cells (PBMCs), we particularly discuss their role in the context of the innate immunity affecting HIV-1 replication.
Topics: HIV-1; Humans; Virus Replication; HIV Infections; Immunity, Innate; Gene Expression Regulation, Viral; RNA Splicing Factors; Interferon Type I; Host-Pathogen Interactions; Interferons; RNA-Binding Proteins
PubMed: 38932230
DOI: 10.3390/v16060938 -
Viruses Jun 2024The HIV envelope glycoprotein (Env) is a trimeric protein that facilitates viral binding and fusion with target cells. As the sole viral protein on the HIV surface, Env...
The HIV envelope glycoprotein (Env) is a trimeric protein that facilitates viral binding and fusion with target cells. As the sole viral protein on the HIV surface, Env is important both for immune responses to HIV and in vaccine designs. Targeting Env in clinical applications is challenging due to its heavy glycosylation, high genetic variability, conformational camouflage, and its low abundance on virions. Thus, there is a critical need to better understand this protein. Flow virometry (FV) is a useful methodology for phenotyping the virion surface in a high-throughput, single virion manner. To demonstrate the utility of FV to characterize Env, we stained HIV virions with a panel of 85 monoclonal antibodies targeting different regions of Env. A broad range of antibodies yielded robust staining of Env, with V3 antibodies showing the highest quantitative staining. A subset of antibodies tested in parallel on viruses produced in CD4 T cell lines, HEK293T cells, and primary cells showed that the cellular model of virus production can impact Env detection. Finally, in addition to being able to highlight Env heterogeneity on virions, we show FV can sensitively detect differences in Env conformation when soluble CD4 is added to virions before staining.
Topics: Humans; env Gene Products, Human Immunodeficiency Virus; HIV-1; Virion; HEK293 Cells; HIV Antibodies; Antibodies, Monoclonal; CD4-Positive T-Lymphocytes; HIV Infections
PubMed: 38932227
DOI: 10.3390/v16060935 -
Viruses Jun 2024The innate immune system, particularly the interferon (IFN) system, constitutes the initial line of defense against viral infections. IFN signaling induces the... (Review)
Review
The innate immune system, particularly the interferon (IFN) system, constitutes the initial line of defense against viral infections. IFN signaling induces the expression of interferon-stimulated genes (ISGs), and their products frequently restrict viral infection. Retroviruses like the human immunodeficiency viruses and the human T-lymphotropic viruses cause severe human diseases and are targeted by ISG-encoded proteins. Here, we discuss ISGs that inhibit the translation of retroviral mRNAs and thereby retrovirus propagation. The Schlafen proteins degrade cellular tRNAs and rRNAs needed for translation. Zinc Finger Antiviral Protein and RNA-activated protein kinase inhibit translation initiation factors, and Shiftless suppresses translation recoding essential for the expression of retroviral enzymes. We outline common mechanisms that underlie the antiviral activity of multifunctional ISGs and discuss potential antiretroviral therapeutic approaches based on the mode of action of these ISGs.
Topics: Humans; Interferons; Retroviridae; Protein Biosynthesis; Immunity, Innate; Animals; Signal Transduction; Retroviridae Infections
PubMed: 38932225
DOI: 10.3390/v16060933 -
Viruses Jun 2024Although antiretroviral therapy (ART) effectively halts disease progression in HIV infection, the complete eradication of the virus remains elusive. Additionally,... (Review)
Review
BACKGROUND
Although antiretroviral therapy (ART) effectively halts disease progression in HIV infection, the complete eradication of the virus remains elusive. Additionally, challenges such as long-term ART toxicity, drug resistance, and the demanding regimen of daily and lifelong adherence required by ART highlight the imperative need for alternative therapeutic and preventative approaches. In recent years, broadly neutralizing antibodies (bNAbs) have emerged as promising candidates, offering potential for therapeutic, preventative, and possibly curative interventions against HIV infection.
OBJECTIVE
This review aims to provide a comprehensive overview of the current state of knowledge regarding the passive immunization of bNAbs in HIV-1-infected individuals.
MAIN FINDINGS
Recent findings from clinical trials have highlighted the potential of bNAbs in the treatment, prevention, and quest for an HIV-1 cure. While monotherapy with a single bNAb is insufficient in maintaining viral suppression and preventing viral escape, ultimately leading to viral rebound, combination therapy with potent, non-overlapping epitope-targeting bNAbs have demonstrated prolonged viral suppression and delayed time to rebound by effectively restricting the emergence of escape mutations, albeit largely in individuals with bNAb-sensitive strains. Additionally, passive immunization with bNAb has provided a "proof of concept" for antibody-mediated prevention against HIV-1 acquisition, although complete prevention has not been obtained. Therefore, further research on the use of bNAbs in HIV-1 treatment and prevention remains imperative.
Topics: Humans; HIV Infections; HIV-1; HIV Antibodies; Antibodies, Neutralizing; Immunization, Passive; Broadly Neutralizing Antibodies; Anti-HIV Agents; Animals
PubMed: 38932203
DOI: 10.3390/v16060911