-
Biology May 2022In this study, thirteen isolates, which were possibly expected to fix nitrogen, were isolated from soil and pea root nodules and identified by the gene analysis of 16S...
In this study, thirteen isolates, which were possibly expected to fix nitrogen, were isolated from soil and pea root nodules and identified by the gene analysis of 16S rDNA sequences. Two of these isolates that were able to form endospores and grow on nitrogen-free media were selected for spring wheat development research. The isolate sp. S7 identified as was found to significantly increase the amount of ammonium and mineral N amounts in the soil. Furthermore, increased nitrogen accumulation in grains and a chlorophyll index were obtained after wheat treatment. sp. S7 isolate was selected for further studies and the accession number MT900581 and strain name MVY-024 in NCBI nucleotide bank for this isolate were assigned. During the cultivation of sp. MVY-024, sugarcane molasses and a yeast extract were determined as the most suitable carbon and nitrogen sources, whose optimal concentrations were 100 g L and 10 g L, respectively. The optimal pH range for the cell culture was between 6.5 and 7.0, and the optimal air flow rate was 0.4 vvm. It was found that the air flow has an effect on biomass production and endospore formation. After sp. MVY-024 biomass cultivation optimization, the cultured cell number was, on average, 2.2 × 10 cfu m L.
PubMed: 35625473
DOI: 10.3390/biology11050745 -
Applied and Environmental Microbiology Jun 2022Despite being unicellular organisms, bacteria undergo complex regulation mechanisms which coordinate different physiological traits. Among others, DegU, DegS, and Spo0A...
Despite being unicellular organisms, bacteria undergo complex regulation mechanisms which coordinate different physiological traits. Among others, DegU, DegS, and Spo0A are the pleiotropic proteins which govern various cellular responses and behaviors. However, the functions and regulatory networks between these three proteins are rarely described in the highly interesting bacterium Paenibacillus polymyxa. In this study, we investigate the roles of DegU, DegS, and Spo0A by introduction of targeted point mutations facilitated by a CRISPR-Cas9-based system. In total, five different mutant strains were generated, the single mutants DegU Q218*, DegS L99F, and Spo0A A257V, the double mutant DegU Q218* DegS L99F, and the triple mutant DegU Q218* DegS L99F Spo0A A257V. Characterization of the wild-type and the engineered strains revealed differences in swarming behavior, conjugation efficiency, sporulation, and viscosity formation of the culture broth. In particular, the double mutant DegU Q218* DegS L99F showed a significant increase in conjugation efficiency as well as a stable exopolysaccharides formation. Furthermore, we highlight similarities and differences in the roles of DegU, DegS, and Spo0A between P. polymyxa and related species. Finally, this study provides novel insights into the complex regulatory system of P. polymyxa DSM 365. To date, only limited knowledge is available on how complex cellular behaviors are regulated in P. polymyxa. In this study, we investigate several regulatory proteins which play a role in governing different physiological traits. Precise targeted point mutations were introduced to their respective genes by employing a highly efficient CRISPR-Cas9-based system. Characterization of the strains revealed some similarities, but also differences, to the model bacterium Bacillus subtilis with regard to the regulation of cellular behaviors. Furthermore, we identified several strains which have superior performance over the wild-type. The applicability of the CRISPR-Cas9 system as a robust genome editing tool, in combination with the engineered strain with increased genetic accessibility, would boost further research in P. polymyxa and support its utilization for biotechnological applications. Overall, our study provides novel insights, which will be of importance in understanding how multiple cellular processes are regulated in species.
Topics: Bacillus subtilis; Bacterial Proteins; CRISPR-Cas Systems; Paenibacillus polymyxa; Point Mutation
PubMed: 35588272
DOI: 10.1128/aem.00164-22 -
Microbiology Resource Announcements Jun 2022We report the complete genome sequence of Paenibacillus polymyxa DSM 365. The genome consists of a 5,788,318-bp chromosome, with a GC content of 45.48%. Annotation of...
We report the complete genome sequence of Paenibacillus polymyxa DSM 365. The genome consists of a 5,788,318-bp chromosome, with a GC content of 45.48%. Annotation of the genome revealed a total of 5,246 genes (average length, 943 bp). Gene function analysis indicated the ability to fix nitrogen (N) and to produce value-added chemicals.
PubMed: 35575559
DOI: 10.1128/mra.00329-22 -
International Journal of Molecular... Apr 2022With numerous industrial applications, has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression...
With numerous industrial applications, has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was "ACTTAGTTTAAGCAATAGACAAAGT", and this can be degenerated to "ACTTWGTTTAWSSNATAVACAAAGT" in spp., which differs from that in the spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter P. The eGFP fluorescence intensity assay indicated that both the modified and original P had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in spp. that can dynamically regulate its gene circuit strength through xylose.
Topics: Gene Expression; Operon; Paenibacillus; Paenibacillus polymyxa; Xylose
PubMed: 35563415
DOI: 10.3390/ijms23095024 -
Life (Basel, Switzerland) Apr 2022Pepper is vulnerable to soil-borne fungal pathogens such as and . The potential of beneficial rhizosphere microorganisms to control and f.sp. was evaluated in pepper...
Pepper is vulnerable to soil-borne fungal pathogens such as and . The potential of beneficial rhizosphere microorganisms to control and f.sp. was evaluated in pepper plants. and were isolated from rhizospheric soil samples of healthy pepper plants. In vitro, both isolates caused clear reductions in the radial growth of root rot and wilt pathogens. Scanning electron microscopy displayed lysis and abnormal shape of the pathogens in dual cultures with and . The incidence and severity of root rot and wilt diseases were significantly reduced in pepper plants treated with the growth-promoting fungi (PGPF isolates; GF19-1, GF18-3, and sp. GS8-3), , or in comparison to the control. Moreover, the induction treatments led to increased pepper growth compared with their control. The defense related gene () expression was shown to be significantly higher in the treated plants than in the control plants. In conclusion, the antagonistic isolates ( and ) and PGPF isolates have a clear impact on the prevention of root rot and wilt diseases in pepper plants incited by and f.sp. The expression of the gene added to the evidence that PGPF isolates generate systemic resistance to pathogen infections.
PubMed: 35455078
DOI: 10.3390/life12040587 -
Frontiers in Chemistry 2022Microbial bactericides have been a research hotspot in recent years. In order to find new microbial fungicides for preventing and treating rice bacterial diseases, Y-1...
Microbial bactericides have been a research hotspot in recent years. In order to find new microbial fungicides for preventing and treating rice bacterial diseases, Y-1 ( Y-1) was isolated from in this study, and the optimal medium was selected by a single-factor experiment, and then eight metabolites were isolated from Y-1 fermentation broth by bioactivity tracking separation. The bioassay results showed that 2,4-di-tert-butylphenol, N-acetyl-5-methoxytryptamine, and P-hydroxybenzoic acid have good antibacterial activity against pv. () and pv. (), with 50% effective concentration values of 49.45 μg/ml, 64.22 μg/ml, and 16.32 μg/ml to , and 34.33 μg/ml, 71.17 μg/ml, and 15.58 μg/ml to , respectively, compared with zhongshengmycin (0.42 and 0.82 μg/ml, respectively) and bismerthiazol (85.64 and 92.49 μg/ml, respectively). experiments found that 2,4-di-tert-butylphenol (35.9 and 35.4%, respectively), N-acetyl-5-methoxytryptamine (42.9 and 36.7%, respectively), and P-hydroxybenzoic acid (40.6 and 36.8%, respectively) demonstrated excellent protective and curative activity against rice bacterial leaf blight, which were better than that of zhongshengmycin (38.4 and 34.4%, respectively). In addition, after 2,4-di-tert-butylphenol, N-acetyl-5-methoxytryptamine, and P-hydroxybenzoic acid acted on rice, SOD, POD, and CAD defense enzymes increased under the same condition. In conclusion, these results indicated that the activity and mechanism research of new microbial pesticides were helpful for the prevention and control of rice bacterial diseases.
PubMed: 35425761
DOI: 10.3389/fchem.2022.879724 -
Frontiers in Cellular and Infection... 2022To discover novel microbial pesticide for controlling rice bacterial disease, polymyxin B and E were firstly isolated from the supernatant of fermentation broth of by...
To discover novel microbial pesticide for controlling rice bacterial disease, polymyxin B and E were firstly isolated from the supernatant of fermentation broth of by bioactivity tracking separation. It is shown that polymyxin B and E had remarkable inhibitory activities to pv. () and pv. () with the EC values of 0.19 μg/ml and 0.21 μg/ml against , and 0.32 μg/ml and 0.41 μg/ml against , respectively, which were better than those of Zhongshengmycin (0.31 μg/ml and 0.73 μg/ml) and Bismerthiazol (77.48 μg/ml and 85.30 μg/ml). Polymyxins B and E had good protection and curative activities against rice bacterial leaf blight (BLB) and rice bacterial leaf streak (BLS) . The protection and curative activities of polymyxins B (45.8 and 35.8%, respectively) and E (41.2 and 37.0%, respectively) to BLB were superior to those of Zhongshengmycin (34.8 and 29.8%, respectively) and Bismerthiazol (38.0 and 33.5%, respectively). Meanwhile, the protection and curative activities of polymyxins B (44.8 and 39.8%, respectively) and E (42.9 and 39.9%, respectively) to BLS were also superior to those of Zhongshengmycin (39.7 and 32.0%, respectively) and Bismerthiazol (41.5 and 34.3%, respectively). Polymyxin B exerted the anti-pesticide properties destroying the cell integrity of , reducing its infectivity and enhancing rice resistance against pathogens through activating the phenylpropanoid biosynthesis pathway of rice. It is indicated that polymyxin B and E were potential microbial pesticides for controlling rice bacterial disease.
Topics: Anti-Bacterial Agents; Bacterial Infections; Oryza; Paenibacillus polymyxa; Plant Diseases; Polymyxins; Xanthomonas
PubMed: 35419296
DOI: 10.3389/fcimb.2022.866357 -
The Journal of General and Applied... Sep 2022Paenibacillus polymyxa is a spore-forming Gram-positive bacterial species. Both its sporulation process and the spore properties are poorly understood. Here, we...
Paenibacillus polymyxa is a spore-forming Gram-positive bacterial species. Both its sporulation process and the spore properties are poorly understood. Here, we investigated sporulation in P. polymyxa ATCC39564. When cultured at 37℃ for 24 h in sporulation medium, more than 80% of the total cells in the culture were spores. Time-lapse imaging revealed that cellular morphological changes during sporulation of P. polymyxa were highly similar to those of B. subtilis. We demonstrated that genetic deletion of spo0A, sigE, sigF, sigG, or sigK, which are highly conserved transcriptional regulators in spore forming bacteria, abolished spore formation. In P. polymyxa, spo0A was required for cell growth in sporulation medium, as well as for the initiation of sporulation. The sigE and sigF mutants formed abnormal multiple asymmetric septa during the early stage of sporulation. The sigG and sigK mutants formed forespores in the sporangium, but they did not become mature. Moreover, fluorescence reporter analysis confirmed compartment-specific gene expression of spoIID and spoVFA in the mother cell and spoIIQ and sspF in the forespore. Transmission electron microscopy imaging revealed that P. polymyxa produces multilayered endospores but lacking a balloon-shaped exosporium. Our results indicate that spore morphogenesis is conserved between P. polymyxa and B. subtilis. However, P. polymyxa genomes lack many homologues encoding spore-coat proteins that are found in B. subtills, suggesting that there are differences in the spore coat composition and surface structure between P. polymyxa and B. subtilis.
Topics: Bacillus subtilis; Bacterial Proteins; Gene Expression Regulation, Bacterial; Morphogenesis; Paenibacillus polymyxa; Spores, Bacterial; Transcription Factors
PubMed: 35418538
DOI: 10.2323/jgam.2021.10.006 -
Frontiers in Microbiology 2022Brewers' spent grains (BSG) are a by-product of the brewing industry that is mainly used as feedstock; otherwise, it has to be disposed according to regulations. Due to...
Brewers' spent grains (BSG) are a by-product of the brewing industry that is mainly used as feedstock; otherwise, it has to be disposed according to regulations. Due to the high content of glucose and xylose, after pretreatment and hydrolysis, it can be used as a main carbohydrate source for cultivation of microorganisms for production of biofuels or biochemicals like 2,3-butanediol or lactate. 2,3-Butanediol has applications in the pharmaceutical or chemical industry as a precursor for varnishes and paints or in the food industry as an aroma compound. So far, , , , and are being used and investigated in different bioprocesses aimed at the production of 2,3-butanediol. The main drawback is bacterial pathogenicity which complicates all production steps in laboratory, pilot, and industrial scales. In our study, a gram-positive GRAS bacterium DSM 742 was used for the production of 2,3-butanediol. Since this strain is very poorly described in literature, bacterium cultivation was performed in media with different glucose and/or xylose concentration ranges. The highest 2,3-butanediol concentration of 18.61 g l was achieved in medium with 70 g l of glucose during 40 h of fermentation. In contrast, during bacterium cultivation in xylose containing medium there was no significant 2,3-butanediol production. In the next stage, BSG hydrolysates were used for bacterial cultivation. DSM 742 cultivated in the liquid phase of pretreated BSG produced very low 2,3-butanediol and ethanol concentrations. Therefore, this BSG hydrolysate has to be detoxified in order to remove bacterial growth inhibitors. After detoxification, bacterium cultivation resulted in 30 g l of lactate, while production of 2,3-butanediol was negligible. The solid phase of pretreated BSG was also used for bacterium cultivation after its hydrolysis by commercial enzymes. In these cultivations, DSM 742 produced 9.8 g l of 2,3-butanediol and 3.93 g l of ethanol. On the basis of the obtained results, it can be concluded that different experimental setups give the possibility of directing the metabolism of DSM 742 toward the production of either 2,3-butanediol and ethanol or lactate.
PubMed: 35308344
DOI: 10.3389/fmicb.2022.812457 -
Journal of Food Science and Technology Jan 2022is a microorganism used for the production of carbohydrate biopolymer levan in this work. Film samples were prepared with different contents of levan/bentonite. Film...
is a microorganism used for the production of carbohydrate biopolymer levan in this work. Film samples were prepared with different contents of levan/bentonite. Film samples were evaluated for thickness, water vapor permeability, tensile strength and elongation properties. The most suitable film composite was chosen to evaluate antimicrobial activity. Antimicrobial properties were determined on different microorganisms by adding calendula oil, citronella oil, lemon oil, tamanu oil, peppermint (medical peppermint) oil in varying amounts to the film samples. The highest activity of levan/bentonite/oil composite film on microorganisms was measured with a diameter of 40 mm on in the composition of 0.5 mL of film content +1.5 mL of peppermint (medical peppermint) oil. This high antimicrobial activity film composite was characterized by TGA and SEM. It was made with levan/bentonite and peppermint oil, and the determination of antimicrobial effects of this film composite was reported for the first time. The bio-degradable film obtained has a high potential for use in different areas, especially in food packaging.
PubMed: 35068569
DOI: 10.1007/s13197-021-05009-4