-
Journal of Experimental Botany Jun 2024Raffinose mitigates plant heat-, drought- and cold- stresses; however, whether raffinose contributes to plant waterlogging tolerance is unknown. The maize zmrafs-1...
Raffinose mitigates plant heat-, drought- and cold- stresses; however, whether raffinose contributes to plant waterlogging tolerance is unknown. The maize zmrafs-1 mutant seedlings lacking raffinose, generate fewer and shorter adventitious root (AR) and are more sensitive to waterlogging stress, while overexpression of ZmRAFS increases raffinose content, stimulates AR formation, and enhances the waterlogging tolerance of maize seedlings. Transcriptome analysis of NS (Null segregant) seedlings compared with that of zmrafs-1, particularly when waterlogged, revealed that the expression of genes related to galactose metabolism and the auxin biosynthetic pathway were upregulated by raffinose. Additionally, Indole-3-acetic acid (IAA) amounts significantly decreased or increased in zmrafs-1 or ZmRAFS-overexpressing seedlings, respectively. Inhibition of the hydrolysis of raffinose by DGJ (1-deoxygalactonojirimycin) decreased the waterlogging tolerance of maize seedlings, decreased the expression of genes encoding proteins related to auxin transport-related genes as well as the IAA level in the seedlings, suggesting that the hydrolysis of raffinose is necessary for maize waterlogging tolerance. These data demonstrate that raffinose catabolism stimulates adventitious root formation via auxin signaling pathway to enhance maize waterlogging tolerance.
PubMed: 38938017
DOI: 10.1093/jxb/erae284 -
Journal of Microbiology and... Jun 2024It remains to be determined whether there is a geographical distribution pattern and phylogenetic signals for the strains with seed germination of the orchid plant ....
It remains to be determined whether there is a geographical distribution pattern and phylogenetic signals for the strains with seed germination of the orchid plant . This study analyzed the community composition and phylogenetics of 72 strains associated with varieties (. f. and . f. ) using multiple gene fragments (ITS+nLSU+SSU). We found that (1) these diverse phylogenetically belong to the Basidiospore amyloid group. (2) There is a phylogenetic signal of for germination of . Those strains phylogenetically close to , , and an unclassified had significantly higher germination rates than those to . (3) The distribution depends on geographic site and variety. Both unclassified group 1 and the group were dominant for the two varieties of ; in contrast, the group was dominant in f. but absent in f. . Our results indicate that the community composition of numerous resources in the Zhaotong area varies by geographical location and variety. Importantly, our results also indicate that 's phylogenetic status is correlated with its germination rate.
Topics: Gastrodia; Phylogeny; Germination; DNA, Fungal; Seeds; Basidiomycota
PubMed: 38938004
DOI: 10.4014/jmb.2401.01009 -
Plant Disease Jun 2024During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas,...
During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas, USA and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Laurel, Maryland for pathogen identification and confirmatory testing. Ribo-depleted libraries for all four samples were prepared for high-throughput sequencing (HTS) analysis, using the RNA extracts of individual grapefruit samples. HTS yielded 13.6 to 22.8 million 75 bp paired-end raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (GenBank accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, a few Caulimoviridae and Retroviridae contigs were also identified in the libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. To know the association of chlorotic blotch symptoms with NeVM, 12 symptomatic and 4 non-symptomatic grapefruit samples were collected for testing (Supplementary Figure 1). A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´)/NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a detection assay. The results of the 671 bp amplicon sequencing showed that 13 (12+1) of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 87.63-92.25% nt identities with the nectarine isolates of NeVM (KT273411-13) and 78% with the Canadian prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived 2019 (TX4) and 2023 leaf tissue samples (LF1 and LF2) from La Feria, TX were selected for genetic analysis. The primer pair Marafi Gen-1F/NeVM-1R targeting the helicase domain of NeVM, successfully amplified the expected 671 bp product. The amplicon sequence of isolate TX4 shared 97.76% and 89.87% nt identities with isolates LF1 and LF2, respectively, while LF1 shared 90.76% nt identity with LF2. Sequence variation was observed for a 1906 bp overlapping amplicon obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´)/Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG3´), spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of TX4 shared 94 and 95% nt identities with LF2 and LF1, respectively, but only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91.08 to 92.29% nt identity with American prunus isolates (KT273411-13) and 75% nt identity with Canadian isolate (MZ291915). Three sequences of 671 bp and 1906 bp amplicons were deposited in GenBank under accession numbers PP767656-61. From the regulatory point of view, NeVM fails to satisfy the criteria to be considered as potential quarantine pests for the European Union because of the absence of information on its biology, distribution, and economic impact (Bragard et al., 2019). However, this report expands the natural host range of NeVM to include grapefruit. From an epidemiological standpoint, more data on host range, varietal susceptibility, and genetic variability among citrus and prunus isolates are needed to conclude the association of NeVM infection with symptoms development.
PubMed: 38937932
DOI: 10.1094/PDIS-05-24-1024-PDN -
Plant Disease Jun 2024Wheat stripe rust is a destructive disease worldwide, caused by f. sp. (). Resistance breeding is the most effective method of controlling stripe rust. Xinjiang is a...
Wheat stripe rust is a destructive disease worldwide, caused by f. sp. (). Resistance breeding is the most effective method of controlling stripe rust. Xinjiang is a relatively independent epidemic region of wheat stripe rust in China. In recent years, wheat stripe rust in this area has shown an upward trend. Therefore, the purpose of this study was to evaluate the resistance level of wheat cultivars (lines) to the prevalent races and determine the genetic background of stripe rust resistance genes in Xinjiang. Six predominant races in China were used to study resistance of 286 wheat cultivars (lines) at both seedling under controlled conditions and adult-plant stages under field conditions. In the seedling tests, 175 (61.19%) entries were resistant to races CYR23, 125 (43.71%) to CYR29, 153 (53.50%) to CYR31, 88 (30.77%) to CYR32, 174 (60.84%) to CYR33, and 98 (34.27%) to CYR34. Among the resistant entries, 23 (8.04%) were resistant to all six races. In the field test, 135 (47.20%) entries were resistant to the tested mixed races. Through comparing the responses in the seedling and adult-plant stages, 109 (38.11%) entries were found to have adult-plant resistance (APR), and 14 (4.90%) entries have all-stage resistance (ASR). The 286 wheat entries were also tested using a wheat breeder chip containing 12 resistance loci. Among these entries, 44 (15.38%) were found to have single gene, 221 (77.27%) have two or more genes, and 21 (7.34%) have none of the 12 genes, including 144 (50.35%) with and 5 (1.75%) with . Entries with two or more genes have stronger resistance to . Overall, the majority of entries have all-stage and/or adult-plant resistance, but their genes for resistance in addition to the 12 tested genes need to be determined. It is also necessary to introduce more effective resistance genes in the breeding programs to improve stripe rust resistance in wheat cultivars in Xinjiang.
PubMed: 38937931
DOI: 10.1094/PDIS-04-24-0780-RE -
BMC Plant Biology Jun 2024Amorphophallus is a perennial monocotyledonous herbaceous plant native to the southwestern region of China, widely used in various fields such as food processing,...
Amorphophallus is a perennial monocotyledonous herbaceous plant native to the southwestern region of China, widely used in various fields such as food processing, biomedicine and chemical agriculture. However, Amorphophallus is a typical thermolabile plant, and the continuous high temperature in summer have seriously affected the growth, development and economic yield of Amorphophallus in recent years. Calmodulin (CaM), a Ca sensor ubiquitous in eukaryotes, is the most important multifunctional receptor protein in plant cells, which affects plant stress resistance by participating in the activities of a variety of signaling molecules. In this study, the key gene AaCaM3 for the Ca-CaM regulatory pathway was obtained from A. albus, the sequence analysis confirmed that it is a typical calmodulin. The qRT-PCR results demonstrated that with the passage of heat treatment time, the expression of AaCaM3 was significantly upregulated in A. albus leaves. Subcellular localization analysis revealed that AaCaM3 localized on the cytoplasm and nucleus. Meanwhile, heterologous transformation experiments have shown that AaCaM3 can significantly improve the heat tolerance of Arabidopsis under heat stress. The promoter region of AaCaM3 was sequenced 1,338 bp by FPNI-PCR and GUS staining assay showed that the promoter of AaCaM3 was a high-temperature inducible promoter. Yeast one-hybrid analysis and Luciferase activity reporting system analysis showed that the AaCaM3 promoter may interact with AaHSFA1, AaHSFA2c, AaHSP70, AaDREB2a and AaDREB2b. In conclusion, this study provides new ideas for further improving the signal transduction network of high-temperature stress in Amorphophallus.
Topics: Calmodulin; Plant Proteins; Arabidopsis; Gene Expression Regulation, Plant; Heat-Shock Response; Hot Temperature; Fabaceae; Plants, Genetically Modified; Stress, Physiological; Promoter Regions, Genetic
PubMed: 38937722
DOI: 10.1186/s12870-024-05283-2 -
BMC Microbiology Jun 2024This study investigated the influence of bacterial cyclic lipopeptides (LP; surfactins, iturins, fengycins) on microbial interactions. The objective was to investigate...
This study investigated the influence of bacterial cyclic lipopeptides (LP; surfactins, iturins, fengycins) on microbial interactions. The objective was to investigate whether the presence of bacteria inhibits fungal growth and whether this inhibition is due to the release of bacterial metabolites, particularly LP. Selected endophytic bacterial strains with known plant-growth promoting potential were cultured in the presence of Fusarium oxysporum f.sp. strigae (Fos), which was applied as model fungal organism. The extracellular metabolome of tested bacteria, with a focus on LP, was characterized, and the inhibitory effect of bacterial LP on fungal growth was investigated. The results showed that Bacillus velezensis GB03 and FZB42, as well as B. subtilis BSn5 exhibited the strongest antagonism against Fos. Paraburkholderia phytofirmans PsJN, on the other hand, tended to have a slight, though non-significant growth promotion effect. Crude LP from strains GB03 and FZB42 had the strongest inhibitory effect on Fos, with a significant inhibition of spore germination and damage of the hyphal structure. Liquid chromatography tandem mass spectrometry revealed the production of several variants of iturin, fengycin, and surfactin LP families from strains GB03, FZB42, and BSn5, with varying intensity. Using plate cultures, bacillomycin D fractions were detected in higher abundance in strains GB03, FZB42, and BSn5 in the presence of Fos. Additionally, the presence of Fos in dual plate culture triggered an increase in bacillomycin D production from the Bacillus strains. The study demonstrated the potent antagonistic effect of certain Bacillus strains (i.e., GB03, FZB42, BSn5) on Fos development. Our findings emphasize the crucial role of microbial interactions in shaping the co-existence of microbial assemblages.
Topics: Fusarium; Lipopeptides; Bacillus; Antibiosis; Antifungal Agents; Peptides, Cyclic; Microbial Interactions; Burkholderiaceae; Spores, Fungal; Hyphae
PubMed: 38937715
DOI: 10.1186/s12866-024-03386-2 -
BMC Plant Biology Jun 2024In acidic soils, aluminum (Al) toxicity inhibits the growth and development of plant roots and affects nutrient and water absorption, leading to reduced yield and...
In acidic soils, aluminum (Al) toxicity inhibits the growth and development of plant roots and affects nutrient and water absorption, leading to reduced yield and quality. Therefore, it is crucial to investigate and identify candidate genes for Al tolerance and elucidate their physiological and molecular mechanisms under Al stress. In this study, we identified a new gene OsAlR3 regulating Al tolerance, and analyzed its mechanism from physiological, transcriptional and metabolic levels. Compared with the WT, malondialdehyde (MDA) and hydrogen peroxide (HO) content were significantly increased, superoxide dismutase (SOD) activity and citric acid (CA) content were significantly decreased in the osalr3 mutant lines when exposed to Al stress. Under Al stress, the osalr3 exhibited decreased expression of antioxidant-related genes and lower organic acid content compared with WT. Integrated transcriptome and metabolome analysis showed the phenylpropanoid biosynthetic pathway plays an important role in OsAlR3-mediated Al tolerance. Exogenous CA and oxalic acid (OA) could increase total root length and enhance the antioxidant capacity in the mutant lines under Al stress. Conclusively, we found a new gene OsAlR3 that positively regulates Al tolerance by promoting the chelation of Al ions through the secretion of organic acids, and increasing the expression of antioxidant genes.
Topics: Aluminum; Oryza; Antioxidants; Gene Expression Regulation, Plant; Plant Proteins; Citric Acid; Plant Roots; Genes, Plant
PubMed: 38937693
DOI: 10.1186/s12870-024-05298-9 -
BMC Plant Biology Jun 2024Caryodaphnopsis, a group of tropical trees (ca. 20 spp.) in the family Lauraceae, has an amphi-Pacific disjunct distribution: ten species are distributed in Southeast...
BACKGROUND
Caryodaphnopsis, a group of tropical trees (ca. 20 spp.) in the family Lauraceae, has an amphi-Pacific disjunct distribution: ten species are distributed in Southeast Asia, while eight species are restricted to tropical rainforests in South America. Previously, phylogenetic analyses using two nuclear markers resolved the relationships among the five species from Latin America. However, the phylogenetic relationships between the species in Asia remain poorly known.
RESULTS
Here, we first determined the complete mitochondrial genome (mitogenome), plastome, and the nuclear ribosomal cistron (nrDNA) sequences of C. henryi with lengths of 1,168,029 bp, 154,938 bp, and 6495 bp, respectively. We found 2233 repeats and 368 potential SSRs in the mitogenome of C. henryi and 50 homologous DNA fragments between its mitogenome and plastome. Gene synteny analysis revealed a mass of rearrangements in the mitogenomes of Magnolia biondii, Hernandia nymphaeifolia, and C. henryi and only six conserved clustered genes among them. In order to reconstruct relationships for the ten Caryodaphnopsis species in Asia, we created three datasets: one for the mitogenome (coding genes and ten intergenic regions), another for the plastome (whole genome), and the other for the nuclear ribosomal cistron. All of the 22 Caryodaphnopsis individuals were divided into four, five, and six different clades in the phylogenies based on mitogenome, plastome, and nrDNA datasets, respectively.
CONCLUSIONS
The study showed phylogenetic conflicts within and between nuclear and organellar genome data of Caryodaphnopsis species. The sympatric Caryodaphnopsis species in Hekou and Malipo SW China may be related to the incomplete lineage sorting, chloroplast capture, and/or hybridization, which mixed the species as a complex in their evolutionary history.
Topics: Phylogeny; Genome, Mitochondrial; Lauraceae; Genome, Plant
PubMed: 38937691
DOI: 10.1186/s12870-024-05050-3 -
BMC Plant Biology Jun 2024Ichang papeda (Citrus ichangensis), a wild perennial plant of the Rutaceae family, is a cold-hardy plant. WRKY transcription factors are crucial regulators of plant...
BACKGROUND
Ichang papeda (Citrus ichangensis), a wild perennial plant of the Rutaceae family, is a cold-hardy plant. WRKY transcription factors are crucial regulators of plant growth and development as well as abiotic stress responses. However, the WRKY genes in C. ichangensis (CiWRKY) and their expression patterns under cold stress have not been thoroughly investigated, hindering our understanding of their role in cold tolerance.
RESULTS
In this study, a total of 52 CiWRKY genes identified in the genome of C. ichangensis were classified into three main groups and five subgroups based on phylogenetic analysis. Comprehensive analyses of motif features, conserved domains, and gene structures were performed. Segmental duplication plays a significant role in the CiWRKY gene family expansion. Cis-acting element analysis revealed the presence of various stress-responsive elements in the promoters of the majority of CiWRKYs. Gene ontology (GO) analysis and protein-protein interaction predictions indicate that the CiWRKYs exhibit crucial roles in regulation of both development and stress response. Expression profiling analysis demonstrates that 14 CiWRKYs were substantially induced under cold stress. Virus-induced gene silencing (VIGS) assay confirmed that CiWRKY31, one of the cold-induced WRKYs, functions positively in regulation of cold tolerance.
CONCLUSION
Sequence and protein properties of CiWRKYs were systematically analyzed. Among the 52 CiWRKY genes 14 members exhibited cold-responsive expression patterns, and CiWRKY31 was verified to be a positive regulator of cold tolerance. These findings pave way for future investigations to understand the molecular functions of CiWRKYs in cold tolerance and contribute to unravelling WRKYs that may be used for engineering cold tolerance in citrus.
Topics: Transcription Factors; Citrus; Cold-Shock Response; Plant Proteins; Phylogeny; Gene Expression Regulation, Plant; Genome, Plant; Gene Expression Profiling; Genes, Plant; Cold Temperature
PubMed: 38937686
DOI: 10.1186/s12870-024-05320-0 -
BMC Plant Biology Jun 2024Salt is an important factor that affects crop productivity. Plant hexokinases (HXKs) are key enzymes in the glycolytic pathway and sugar signaling transduction pathways...
BACKGROUND
Salt is an important factor that affects crop productivity. Plant hexokinases (HXKs) are key enzymes in the glycolytic pathway and sugar signaling transduction pathways of plants. In previous studies, we identified and confirmed the roles of GmHXK2 in salt tolerance.
RESULTS
In this study, we analyzed the tissue-specific expression of GmHXK2 at different growth stages throughout the plant's life cycle. The results showed that GmHXK2 was expressed significantly in all tissues at vegetative stages, including germination and seedling. However, no expression was detected in the pods, and there was little expression in flowers during the later mature period. Arabidopsis plants overexpressing the GmHXK2 (OE) had more lateral roots. The OE seedlings also produced higher levels of auxin and ascorbic acid (AsA). Additionally, the expression levels of genes PMM, YUC4/YUC6/YUC8, and PIN/LAX1,LAX3, which are involved respectively in the synthesis of AsA and auxin, as well as polar auxin transport, were upregulated in OE plants. This upregulation occurred specifically under exogenous glucose treatment. AtHKT1, AtSOS1, and AtNHX1 were up-regulated in OE plants under salt stress, suggesting that GmHXK2 may modulate salt tolerance by maintaining ion balance within the cells and alleviating damage caused by salt stress. Additionally, we further confirmed the interaction between GmHXK2 and the protein GmPMM through yeast two-hybridization and bimolecular fluorescence complementation assays, respectively.
CONCLUSION
The expression of GmHXK2 gene in plants is organ-specific and developmental stage specific. GmHXK2 not only regulates the synthesis of AsA and the synthesis and distribution of auxin, but also promotes root elongation and induces lateral root formation, potentially enhancing soil water absorption. This study reveals the crosstalk between sugar signaling and hormone signaling in plants, where GmHXK2 acts as a glucose sensor through its interaction with GmPMM, and sheds light on the molecular mechanism by which GmHXK2 gene is involved in salt tolerance in plants.
Topics: Seedlings; Indoleacetic Acids; Salt Tolerance; Glycine max; Ascorbic Acid; Gene Expression Regulation, Plant; Plant Proteins; Arabidopsis; Plants, Genetically Modified
PubMed: 38937682
DOI: 10.1186/s12870-024-05301-3