-
BioRxiv : the Preprint Server For... May 2024Mutations in the human Ocular albinism type-1 gene are associated with abnormal retinal pigment epithelium (RPE) melanogenesis and poor binocular vision resulting from...
Mutations in the human Ocular albinism type-1 gene are associated with abnormal retinal pigment epithelium (RPE) melanogenesis and poor binocular vision resulting from misrouting of ipsilateral retinal ganglion cell (iRGC) axons to the brain. We studied the latter using wild-type (WT) and mouse eyes. At embryonic stages, the WT RPE-specific Oa1 protein signals through cAMP/Epac1-Erk2-CREB. Following CREB phosphorylation, a pCREB gradient extends from the RPE to the differentiating retinal amacrine and RGCs. In contrast to WT, the RPE and ventral ciliary-margin-zone, a niche for iRGCs, express less pCREB while their retinas have a disrupted pCREB gradient, indicating Oa1's involvement in pCREB maintenance. retinas also show hyperproliferation, enlarged nuclei, reduced differentiation, and fewer newborn amacrine and RGCs than WT retinas. Our results demonstrate that Oa1's absence leads to reduced binocular vision through a hyperproliferation-associated block in differentiation that impairs neurogenesis. This may affect iRGC axon's routing to the brain.
PubMed: 38798688
DOI: 10.1101/2024.05.14.594013 -
Scientific Reports Mar 2024The purpose of this paper is to expand on the phenotype of oculocutaneous albinism type 7 (OCA7). We described three patients with OCA7: two from a consanguineous family...
The purpose of this paper is to expand on the phenotype of oculocutaneous albinism type 7 (OCA7). We described three patients with OCA7: two from a consanguineous family of Kurdish origin and one patient of Dutch origin. We compared them with all patients described to date in the literature. All newly described patients had severely reduced visual acuity (VA), nystagmus, hypopigmentation of the fundus, severe foveal hypoplasia, and chiasmal misrouting. None had iris translucency. All patients had normal pigmentation of skin and hair. We found one novel mutation in the Dutch patient: c.565G > A; p.(Gly189Ser). We compared our patients to the 15 described in the literature to date. All 18 patients had substantially pigmented skin and hair, very poor VA (0.4-1.3 logMAR), nystagmus, (mild) ocular hypopigmentation, foveal hypoplasia, and misrouting. Although pigmentation levels were mildly affected in OCA7, patients had a severe ocular phenotype with VA at the poorer end of the albinism spectrum, severe foveal hypoplasia, and chiasmal misrouting. OCA7 patients had a phenotype restricted to the eyes, and similar to that of X-linked ocular albinism. We therefore propose to rename the disorder in ocular albinism type 2. Unfolding the role of LRMDA in OCA7, may bring us a step closer in identifying the responsible factors for the co-occurrence of foveal hypoplasia and misrouting.
Topics: Humans; Albinism, Ocular; Albinism, Oculocutaneous; Nystagmus, Pathologic; Hypopigmentation; Retina; Mutation; Vision Disorders
PubMed: 38555393
DOI: 10.1038/s41598-024-57969-0 -
Oman Journal of Ophthalmology 2024A 48-year-old male with oculocutaneous albinism (OCA) presented with bilateral diminution of vision. Ocular examination revealed bilateral central corneal thinning,...
A 48-year-old male with oculocutaneous albinism (OCA) presented with bilateral diminution of vision. Ocular examination revealed bilateral central corneal thinning, scarring with ectasia, depigmented irides, transillumination defects, and pseudophakia. Examination of the right eye also revealed a hyperoleon, emulsified silicon oil in the vitreous cavity, and an attached retina, while the left eye had a total rhegmatogenous retinal detachment (RRD). This case describes a unique set of challenges (the presence of an ectatic scarred cornea and a hypopigmented fundus) and sodium fluorescein dye as an adjunct in the surgical management of a complex RRD. A review of literature highlighting the association of keratoconus and RRD in OCA is also presented in this report.
PubMed: 38524338
DOI: 10.4103/ojo.ojo_35_23 -
International Journal of Molecular... Mar 2024Aland island eye disease (AIED), an incomplete form of X-linked congenital stationary night blindness (CSNB2A), and X-linked cone-rod dystrophy type 3 (CORDX3) display...
Aland island eye disease (AIED), an incomplete form of X-linked congenital stationary night blindness (CSNB2A), and X-linked cone-rod dystrophy type 3 (CORDX3) display many overlapping clinical findings. They result from mutations in the gene encoding the α subunit of the Cav1.4 channel, which plays a key role in neurotransmission from rod and cone photoreceptors to bipolar cells. Case report: A 57-year-old Caucasian man who had suffered since his early childhood from nystagmus, nyctalopia, low visual acuity and high myopia in both eyes (OU) presented to expand the diagnostic process, because similar symptoms had occurred in his 2-month-old grandson. Additionally, the patient was diagnosed with protanomalous color vision deficiency, diffuse thinning, and moderate hypopigmentation of the retina. Optical coherence tomography of the macula revealed retinoschisis in the right eye and foveal hypoplasia in the left eye. Dark-adapted (DA) 3.0 flash full-field electroretinography (ffERG) amplitudes of a-waves were attenuated, and the amplitudes of b-waves were abolished, which resulted in a negative pattern of the ERG. Moreover, the light-adapted 3.0 and 3.0 flicker ffERG as well as the DA 0.01 ffERG were consistent with severely reduced responses OU. Genetic testing revealed a hemizygous form of a stop-gained mutation (c.4051C>T) in exon 35 of the gene. This pathogenic variant has so far been described in combination with a phenotype corresponding to CSNB2A and CORDX3. This report contributes to expanding the knowledge of the clinical spectrum of -related disease. Wide variability and the overlapping clinical manifestations observed within AIED and its allelic disorders may not be explained solely by the consequences of different mutations on proteins. The lack of distinct genotype-phenotype correlations indicates the presence of additional, not yet identified, disease-modifying factors.
Topics: Male; Humans; Child, Preschool; Infant; Middle Aged; Retinoschisis; Calcium Channels, L-Type; Genetic Diseases, X-Linked; Retinal Diseases; Retina; Mutation; Night Blindness; Myopia; Albinism, Ocular; Retinitis Pigmentosa; Eye Diseases, Hereditary
PubMed: 38474172
DOI: 10.3390/ijms25052928 -
International Journal of Molecular... Jan 2024Albinism is characterized by a variable degree of hypopigmentation affecting the skin and the hair, and causing ophthalmologic abnormalities. Its oculocutaneous, ocular...
Albinism is characterized by a variable degree of hypopigmentation affecting the skin and the hair, and causing ophthalmologic abnormalities. Its oculocutaneous, ocular and syndromic forms follow an autosomal or X-linked recessive mode of inheritance, and 22 disease-causing genes are implicated in their development. Our aim was to clarify the genetic background of a Hungarian albinism cohort. Using a 22-gene albinism panel, the genetic background of 11 of the 17 Hungarian patients was elucidated. In patients with unidentified genetic backgrounds ( = 6), whole exome sequencing was performed. Our investigations revealed a novel, previously unreported rare variant (N687S) of the two-pore channel two gene (). The N687S variant of the encoded TPC2 protein is carried by a 15-year-old Hungarian male albinism patient and his clinically unaffected mother. Our segregational analysis and in vitro functional experiments suggest that the detected novel rare variant alone is not a disease-causing variant in albinism. Deep genetic analyses of the family revealed that the patient also carries a phenotype-modifying R305W variant of the OCA2 protein, and he is the only family member harboring this genotype. Our results raise the possibility that this digenic combination might contribute to the observed differences between the patient and the mother, and found the genetic background of the disease in his case.
Topics: Humans; Male; Adolescent; Hungary; Mutation; Membrane Transport Proteins; Albinism; Genetic Background
PubMed: 38279271
DOI: 10.3390/ijms25021271 -
Molecular Vision 2023Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes....
PURPOSE
Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation.
METHODS
A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of . Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations.
RESULTS
Genetic analysis identified 11 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a mutation were found to present a typical or atypical phenotype of OA1. All patients with mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia.
CONCLUSIONS
We discovered seven novel mutations and four previously reported mutations of in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.
Topics: Humans; Albinism, Ocular; Eye Proteins; Genetic Diseases, X-Linked; Iris; Membrane Glycoproteins; Mutation; Nystagmus, Congenital; Pedigree
PubMed: 38222445
DOI: No ID Found -
Children (Basel, Switzerland) Dec 2023(1) Background: The aim of the study was to describe refractive development from early childhood to adulthood in Danish patients with albinism and to evaluate the effect...
(1) Background: The aim of the study was to describe refractive development from early childhood to adulthood in Danish patients with albinism and to evaluate the effect of foveal developmental stage on refractive development; (2) Methods: Patients with a clinical diagnosis of ocular or oculocutaneous albinism were invited for a refractive evaluation and comprehensive phenotyping including macular optical coherence tomography (OCT) scans. Foveal hypoplasia was graded based on OCT from 0 (normal) to 4 (absence of any signs of foveal specialization). Medical files were reviewed for historical refractive values in individual patients; (3) Results: Hyperopia (spherical equivalent refraction (SEQ) of ≥+1 Diopter (D)) was common in both children (81.3%) and adults (67.1%). The lower prevalence of hyperopia in adults was predominantly explained by increasing astigmatism with age. Emmetropization (>2D change from before 3 years to adolescence) was seen in 22.2%. There was no influence on foveal hypoplasia grade on the degree of refractive errors throughout life; (4) Conclusions: We found that emmetropization was uncommon in Danish patients with albinism and that the degree of foveal developmental stage did not influence emmetropization or the distribution of refractive errors. High degrees of hyperopia and astigmatism were common. These results indicate that fear of impeding emmetropization should not refrain the clinician from providing adequate correction for refractive errors in young children with albinism.
PubMed: 38136112
DOI: 10.3390/children10121910 -
Ophthalmic Research 2024Hermansky-Pudlak syndrome (HPS) is a rare autosomal-recessive disease characterized by ocular albinism (OA) or oculocutaneous albinism (OCA), platelet dysfunction, and...
INTRODUCTION
Hermansky-Pudlak syndrome (HPS) is a rare autosomal-recessive disease characterized by ocular albinism (OA) or oculocutaneous albinism (OCA), platelet dysfunction, and other symptoms. This study aimed to analyze the molecular defect in two Chinese families with suspected OA, as well as to investigate the profile of HPS6 variants and their genotype-phenotype correlations.
METHODS
Seven members from two families were recruited and underwent clinical ophthalmologic examinations. The genomic DNA was extracted from peripheral blood leukocytes. Whole-exome sequencing was performed on the proband of family JX. The single coding exon of HPS6 was directly Sanger sequenced based on PCR amplification in all available family members. An additional 46 probands from families or sporadic cases with the pathogenic variants of HPS6 reported in the literature were reviewed.
RESULTS
We identified two different compound heterozygous truncating variants of HPS6 in probands with suspected OA from two independent families. The proband of family JX had c.1674dup and c.503-504del variants, and the other proband from family CZ had a nonsense variant of c.1114C>T and a frameshift variant of c.1556del. Among them, c.1674dup and c.1556del variants in HPS6 have not been reported previously. Therefore, our patients were diagnosed as HPS6 disease by molecular diagnostics. In the retrospective cohort of HPS6 patients, we delineated the profile of HPS6 variants and revealed a significant overlap between CpG islands and the variants of HPS6, suggesting a potential link between DNA methylation and HPS6 variants. We also observed a spatial aggregation of the variants in 3D structure of HPS6 protein, implying the possible functional significance of these structural regions. In addition, we did not find any significant genotype-phenotype correlation of HPS6, and neither did we observe a correlation between the truncation length of the HPS6 protein and the phenotype of HPS6 disease.
CONCLUSION
Our research expands the spectrum of HPS6 variants, providing a comprehensive delineation of their profile and systematically investigating genotype-phenotype correlations in HPS6. These findings could offer potentially valuable clues for investigating the molecular mechanism underlying HPS6 pathogenesis, as well as aiding the clinical diagnosis of HPS6 patients and improving disease prognosis.
Topics: Humans; Albinism, Ocular; Retrospective Studies; Hermanski-Pudlak Syndrome; Phenotype; Proteins; Mutation; Pedigree; Intracellular Signaling Peptides and Proteins
PubMed: 38091959
DOI: 10.1159/000535788 -
BMC Ophthalmology Oct 2023The aim of this study was to evaluate and summarize the developmental rules of the ocular anterior segment of neonates by means of wild-field digital imaging system.
PURPOSE
The aim of this study was to evaluate and summarize the developmental rules of the ocular anterior segment of neonates by means of wild-field digital imaging system.
METHODS
We used the wide-field digital imaging system to sequentially capture images of the neonates' eyes within 42 days after delivery, including the ocular surface, anterior segment, and fundus. At the same time, basic information at the time of birth and examination was collected.
RESULTS
Among 248 newborns, 51.21% were male. Abnormalities of the anterior segment such as visualization of anterior chamber angle vessels (79.03%) and iris vessels (51.21%), iris process (42.34%), persistent pupillary membranes (19.35%), albinism, congenital cataracts, corneal leucoma, and subconjunctival hemorrhage were observed in this study. There were significant differences in the appearance of iris vessels among different sex, gestational age and birth weight, postmenstrual age and weight at the time of examination and iris color groups. The iris vessels were more visualized in males relative to females (OR = 6.313, 95% CI 2.529-15.759). The greater the postmenstrual age at the time of examination, the lower the visualization of iris vessels (OR = 0.377, 95% CI 0.247-0.575). In addition, although visualization of anterior chamber angle vessels differed within the birth gestation age and weight at examination groups, there was no significant correlation by regression analysis.
CONCLUSIONS
The anterior segment of perinatal neonates can be visualized by the wide-field digital imaging system. The neonatal iris and anterior chamber angle are immature, and the visible vessels at the anterior chamber angle that vanish later than the surface of the iris are characteristic structures.
Topics: Female; Humans; Male; Infant, Newborn; Cross-Sectional Studies; Intraocular Pressure; Glaucoma, Angle-Closure; Tomography, Optical Coherence; Iris; Anterior Chamber; Anterior Eye Segment
PubMed: 37828431
DOI: 10.1186/s12886-023-03139-1 -
European Journal of Ophthalmology May 2024The association between Autism spectrum disorders (ASD) and visual impairment has been mentioned in the literature. The aim of our study was to investigate the...
BACKGROUND
The association between Autism spectrum disorders (ASD) and visual impairment has been mentioned in the literature. The aim of our study was to investigate the prevalence of autism among children with albinism compared to the prevalence of ASD in children with visual impairment secondary to other causes.
METHODS
Retrospective study of children with albinism from January 2015 to December 2020. A control group was created with children with early onset visual impairment of similar visual range and age, secondary to diagnosis other than albinism. Patients with associated Autism were identified in both groups.
RESULTS
Seven hundred and eight children aged 1-18 years with visual impairment were included in the study. 401 children had a diagnosis of albinism, of whom 14 were also diagnosed with ASD. In the control group, composed of 307 patients, only 3 had ASD (p: 0·03).
CONCLUSIONS
The prevalence of ASD in patients with albinism was 1 in 28, while in children with visual impairment from other causes was 1 in 102. We aim to raise awareness of the higher prevalence of autism in children diagnosed with albinism in order to reach earlier diagnosis and support.
Topics: Humans; Retrospective Studies; Child; Prevalence; Male; Female; Child, Preschool; Adolescent; Infant; Visual Acuity; Albinism, Ocular; Autism Spectrum Disorder
PubMed: 37787167
DOI: 10.1177/11206721231206091