-
Invertebrate Neuroscience : IN Mar 2007Voltage-gated sodium channels are essential for the generation and propagation of action potentials (i.e., electrical impulses) in excitable cells. Although most of our... (Review)
Review
Voltage-gated sodium channels are essential for the generation and propagation of action potentials (i.e., electrical impulses) in excitable cells. Although most of our knowledge about sodium channels is derived from decades of studies of mammalian isoforms, research on insect sodium channels is revealing both common and unique aspects of sodium channel biology. In particular, our understanding of the molecular dynamics and pharmacology of insect sodium channels has advanced greatly in recent years, thanks to successful functional expression of insect sodium channels in Xenopus oocytes and intensive efforts to elucidate the molecular basis of insect resistance to insecticides that target sodium channels. In this review, I discuss recent literature on insect sodium channels with emphases on the prominent role of alternative splicing and RNA editing in the generation of functionally diverse sodium channels in insects and the current understanding of the interactions between insect sodium channels and insecticides.
Topics: Action Potentials; Animals; Drug Resistance; Exons; Genetic Variation; Insecta; Insecticides; Models, Molecular; Protein Conformation; RNA Editing; Sodium Channels
PubMed: 17206406
DOI: 10.1007/s10158-006-0036-9 -
The Journal of Physiology Jun 2012Voltage-gated sodium channels initiate action potentials in nerve, muscle and other excitable cells. The sodium current that initiates the nerve action potential was... (Review)
Review
Voltage-gated sodium channels initiate action potentials in nerve, muscle and other excitable cells. The sodium current that initiates the nerve action potential was discovered by Hodgkin and Huxley using the voltage clamp technique in their landmark series of papers in The Journal of Physiology in 1952. They described sodium selectivity, voltage-dependent activation and fast inactivation, and they developed a quantitative model for action potential generation that has endured for many decades. This article gives an overview of the legacy that has evolved from their work, including development of conceptual models of sodium channel function, discovery of the sodium channel protein, analysis of its structure and function, determination of its structure at high resolution, definition of the mechanism and structural basis for drug block, and exploration of the role of the sodium channel as a target for disease mutations. Structural models for sodium selectivity and conductance, voltage-dependent activation, fast inactivation and drug block are discussed. A perspective for the future envisions new advances in understanding the structural basis for sodium channel function, the role of sodium channels in disease and the opportunity for discovery of novel therapeutics.
Topics: Animals; Humans; Protein Conformation; Protein Subunits; Sodium Channels
PubMed: 22473783
DOI: 10.1113/jphysiol.2011.224204 -
BMC Neurology Sep 2021Many antiseizure medications (ASMs) control seizures by blocking voltage-dependent sodium channels. Polymorphisms of sodium channel genes may affect the response to ASMs...
BACKGROUND
Many antiseizure medications (ASMs) control seizures by blocking voltage-dependent sodium channels. Polymorphisms of sodium channel genes may affect the response to ASMs due to altering the effect of ASMs on blocking sodium channels.
METHODS
We conducted a retrospective study of epilepsy patients followed up at the Neurological Department of Kaohsiung Chang Gung Memorial Hospital, Taiwan between January 2010 and December 2018. We categorized the patients into response, partial response, and failure to sodium channel blocking ASM groups. Sodium channel blocking ASMs included phenytoin, carbamazepine, lamotrigine, oxcarbazepine, lacosamide, zonisamide, topiramate, and valproic acid. A subgroup of predominant sodium channel blocking ASMs included phenytoin, carbamazepine, lamotrigine, oxcarbazepine, and lacosamide. Associations between the response of ASMs and single-nucleotide polymorphisms of SCN1A, SCN1B, SCN2A, and SCN9A were analyzed.
RESULTS
Two hundred Taiwanese patients and 21 single-nucleotide polymorphisms among SCN1A, SCN1B, SCN2A, and SCN9A were evaluated. We found allele C of rs55742440 in SCN1B was statistically significantly associated with not achieving seizure-free with sodium channel blocking ASMs. For the predominant sodium channel blocking ASMs group, no SNPs were associated with the response of ASMs.
CONCLUSION
Single-nucleotide polymorphism in SCN1B was associated with the response to sodium channel blocking ASMs. This highlights the possibility that beta subunits may affect the function of sodium channels and resulted in different responsiveness to ASMs.
Topics: Anticonvulsants; Epilepsy; Humans; Lamotrigine; NAV1.7 Voltage-Gated Sodium Channel; Retrospective Studies; Sodium Channels
PubMed: 34556045
DOI: 10.1186/s12883-021-02395-2 -
Molecular Pharmacology Jul 2015Voltage-gated sodium channels initiate action potentials in nerve, muscle, and other electrically excitable cells. Voltage-gated calcium channels are activated by... (Review)
Review
Voltage-gated sodium channels initiate action potentials in nerve, muscle, and other electrically excitable cells. Voltage-gated calcium channels are activated by depolarization during action potentials, and calcium influx through them is the key second messenger of electrical signaling, initiating secretion, contraction, neurotransmission, gene transcription, and many other intracellular processes. Drugs that block sodium channels are used in local anesthesia and the treatment of epilepsy, bipolar disorder, chronic pain, and cardiac arrhythmia. Drugs that block calcium channels are used in the treatment of epilepsy, chronic pain, and cardiovascular disorders, including hypertension, angina pectoris, and cardiac arrhythmia. The principal pore-forming subunits of voltage-gated sodium and calcium channels are structurally related and likely to have evolved from ancestral voltage-gated sodium channels that are widely expressed in prokaryotes. Determination of the structure of a bacterial ancestor of voltage-gated sodium and calcium channels at high resolution now provides a three-dimensional view of the binding sites for drugs acting on sodium and calcium channels. In this minireview, we outline the different classes of sodium and calcium channel drugs, review studies that have identified amino acid residues that are required for their binding and therapeutic actions, and illustrate how the analogs of those key amino acid residues may form drug-binding sites in three-dimensional models derived from bacterial channels.
Topics: Action Potentials; Animals; Binding Sites; Calcium Channel Blockers; Calcium Channels; Humans; Mammals; Sodium Channel Blockers; Sodium Channels; Structural Homology, Protein
PubMed: 25848093
DOI: 10.1124/mol.114.097659 -
Physiological Reviews Oct 2005Voltage-gated sodium channels open (activate) when the membrane is depolarized and close on repolarization (deactivate) but also on continuing depolarization by a... (Review)
Review
Voltage-gated sodium channels open (activate) when the membrane is depolarized and close on repolarization (deactivate) but also on continuing depolarization by a process termed inactivation, which leaves the channel refractory, i.e., unable to open again for a period of time. In the "classical" fast inactivation, this time is of the millisecond range, but it can last much longer (up to seconds) in a different slow type of inactivation. These two types of inactivation have different mechanisms located in different parts of the channel molecule: the fast inactivation at the cytoplasmic pore opening which can be closed by a hinged lid, the slow inactivation in other parts involving conformational changes of the pore. Fast inactivation is highly vulnerable and affected by many chemical agents, toxins, and proteolytic enzymes but also by the presence of beta-subunits of the channel molecule. Systematic studies of these modulating factors and of the effects of point mutations (experimental and in hereditary diseases) in the channel molecule have yielded a fairly consistent picture of the molecular background of fast inactivation, which for the slow inactivation is still lacking.
Topics: Anesthetics, Local; Animals; Electrophysiology; Humans; Kinetics; Membrane Potentials; Muscle, Skeletal; Point Mutation; Protein Isoforms; Sodium Channel Blockers; Sodium Channels
PubMed: 16183913
DOI: 10.1152/physrev.00024.2004 -
Epilepsia Nov 2002Animal experiments, and particularly functional investigations on human chronically epileptic tissue as well as genetic studies in epilepsy patients and their families... (Review)
Review
Animal experiments, and particularly functional investigations on human chronically epileptic tissue as well as genetic studies in epilepsy patients and their families strongly suggest that some forms of epilepsy may share a pathogenetic mechanism: an alteration of voltage-gated sodium channels. This review summarizes recent data on changes of sodium channel expression, molecular structure and function associated with epilepsy, as well as on the interaction of new and established antiepileptic drugs with sodium currents. Although it remains to be determined precisely how and to what extent altered sodium-channel functions play a role in different epilepsy syndromes, future promising therapy approaches may include drugs modulating sodium currents, and particularly substances changing their inactivation characteristics.
Topics: Animals; Anticonvulsants; Chronic Disease; Electric Conductivity; Electrophysiology; Epilepsy; Gene Expression; Humans; Ion Channel Gating; Mutation; Sodium Channels
PubMed: 12423377
DOI: 10.1046/j.1528-1157.2002.40501.x -
Molecular Pain Nov 2010Nociception requires transduction and impulse electrogenesis in nerve fibers which innervate the body surface, including the skin. However, the molecular substrates for...
BACKGROUND
Nociception requires transduction and impulse electrogenesis in nerve fibers which innervate the body surface, including the skin. However, the molecular substrates for transduction and action potential initiation in nociceptors are incompletely understood. In this study, we examined the expression and distribution of Na+/Ca2+ exchanger (NCX) and voltage-gated sodium channel isoforms in intra-epidermal free nerve terminals.
RESULTS
Small diameter DRG neurons exhibited robust NCX2, but not NCX1 or NCX3 immunolabeling, and virtually all PGP 9.5-positive intra-epidermal free nerve terminals displayed NCX2 immunoreactivity. Sodium channel NaV1.1 was not detectable in free nerve endings. In contrast, the majority of nerve terminals displayed detectable levels of expression of NaV1.6, NaV1.7, NaV1.8 and NaV1.9. Sodium channel immunoreactivity in the free nerve endings extended from the dermal boundary to the terminal tip. A similar pattern of NCX and sodium channel immunolabeling was observed in DRG neurons in vitro.
CONCLUSIONS
NCX2, as well as NaV1.6, NaV1.7, NaV1.8 and NaV1.9, are present in most intra-epidermal free nerve endings. The presence of NCX2, together with multiple sodium channel isoforms, in free nerve endings may have important functional implications.
Topics: Animals; Epidermis; Immunohistochemistry; Male; NAV1.7 Voltage-Gated Sodium Channel; NAV1.8 Voltage-Gated Sodium Channel; NAV1.9 Voltage-Gated Sodium Channel; Nerve Endings; Neuropeptides; Nociceptors; Protein Isoforms; Rats; Rats, Sprague-Dawley; Sodium Channels; Sodium-Calcium Exchanger
PubMed: 21118538
DOI: 10.1186/1744-8069-6-84 -
Annals of Medicine Dec 2022Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The...
BACKGROUND
Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis.
METHODS
Blood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation.
RESULTS
Within SCN1A gene we found that the rs6432861 ( = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy.
CONCLUSION
In light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.
Topics: Epilepsy; Humans; NAV1.1 Voltage-Gated Sodium Channel; NAV1.2 Voltage-Gated Sodium Channel; NAV1.3 Voltage-Gated Sodium Channel; Polymorphism, Genetic; Prognosis; Saudi Arabia; Sodium Channels; Voltage-Gated Sodium Channel beta-1 Subunit
PubMed: 35801810
DOI: 10.1080/07853890.2022.2096257 -
Toxicon : Official Journal of the... Feb 2007Site-3 toxins are small polypeptide venoms from scorpions, sea anemones, and spiders that bind with a high specificity to the extracellular surface of voltage-gated Na... (Review)
Review
Site-3 toxins are small polypeptide venoms from scorpions, sea anemones, and spiders that bind with a high specificity to the extracellular surface of voltage-gated Na channels. After binding to a site near the S4 segment in domain IV the toxin causes disruption of the normal fast inactivation transition resulting in a marked prolongation of the action potentials of excitable tissues including those of cardiac and skeletal muscle and nerve. In this review we discuss the specific binding interactions between residues of the toxin and those of the Na channel, and the specific modification of Na channel kinetic behavior leading to a change in fast inactivation focusing on interactions deduced primarily from the study of sea anemone toxins and the cardiac Na channel (Na(V)1.5). We also illustrate the usefulness of site-3 toxins in the study of altered Na channel behavior by drug-modification.
Topics: Animals; Cnidarian Venoms; Humans; Ion Channel Gating; NAV1.3 Voltage-Gated Sodium Channel; Scorpion Venoms; Sea Anemones; Sodium Channels; Spider Venoms; Venoms; Voltage-Gated Sodium Channel beta-3 Subunit
PubMed: 17092528
DOI: 10.1016/j.toxicon.2006.09.017 -
Channels (Austin, Tex.) 2018Although sodium channels have been a hot multidisciplinary focus for decades and most of nerve system drugs worked on alerting sodium channel function, the trends and...
Although sodium channels have been a hot multidisciplinary focus for decades and most of nerve system drugs worked on alerting sodium channel function, the trends and future directions of sodium channel studies have not been comprehensive analyzed bibliometrically. Herein, we collected the scientific publications of sodium channels research and constructed a model to evaluate the current trend systematically. Publications were selected from the Web of Science Core Collection (WoSCC) database from 2013 to 2017. Microsoft Excel 2016, Prism 6, and CiteSpace V software were used to analyze publication outputs, journal sources, countries, territories, institutions, authors, and research areas. A total of 4,275 publications on sodium channel research were identified. PLoS ONE ranked top for publishing 170 papers. The United States of America had the largest number of publications (1,595), citation frequency (19,490), and H-index (53). S. G. Waxman (62 publications) and W. A. Catterall (585 citations) were the most productive authors and had the greatest co-citation counts. This is the first report that shows the trends and future development in sodium channel publications, and our study provides a clear profile for the contribution to this field by countries, authors, keywords, and institutions.
Topics: Bibliometrics; Databases, Protein; Humans; Publishing; Research; Sodium Channels
PubMed: 30134757
DOI: 10.1080/19336950.2018.1511513