-
Viruses Aug 2023HPV has been linked to the development of precancerous and cancerous lesions. The aim of this study was to evaluate the burden of HPV-related hospitalization in Germany...
UNLABELLED
HPV has been linked to the development of precancerous and cancerous lesions. The aim of this study was to evaluate the burden of HPV-related hospitalization in Germany from 2000 to 2021 and the potential impact of the COVID-19 pandemic on it.
METHODS
We performed a retrospective query using data from the German Statistical Office from 2000 to 2021, including hospital admission, inpatient mortality and hospital stay length data on cervical cancer/dysplasia, female genitourinary tract, anal, penile, head and neck cancers.
RESULTS
The HPV-attributable hospitalization rate per 100,000 inhabitants in Germany has decreased over time, from 89 cases in 2000 to 60 in 2021, with an average annual percent change (AAPC) of -1.93 (CI -2.08--1.79, < 0.05). The same trend was observed for the average hospital stay, which declined from 9 to 7 days, with an AAPC of -1.33 (CI -1.52--1.21, < 0.05). An undulating but overall slightly declining pattern was observed for the inpatient mortality (AAPC -0.92, CI -1.21--0.64, < 0.05). We observed a reduction in the hospitalization rates for invasive and non-invasive cervical cancer, which was observed in almost all age groups and in all German federal states.
CONCLUSION
Our study provides a comprehensive analysis of the trends in HPV-related hospitalizations over the past two decades. The decline in hospitalization rates for cervical cancer and dysplasia suggests the potential efficacy of the HPV vaccination and screening programs.
Topics: Female; Humans; Uterine Cervical Neoplasms; Pandemics; Papillomavirus Infections; Retrospective Studies; COVID-19; Hospitalization; Germany; Hyperplasia
PubMed: 37766265
DOI: 10.3390/v15091857 -
BMJ Case Reports Dec 2021A 26-year-old woman under immunosuppression with infliximab due to Crohn's disease was referred to the gynaecology emergency room with dispersed and coalescing vesicular...
A 26-year-old woman under immunosuppression with infliximab due to Crohn's disease was referred to the gynaecology emergency room with dispersed and coalescing vesicular lesions on the vulvar region extending to the right lower limb involving S2-S3 dermatome, associated with severe pain. Clinical history, physical examination and serological testing was consistent with herpes zoster infection. The patient was treated with valaciclovir for 14 days and cefradine for 7 days (due to the possibility of secondary bacterial infection). Significant symptomatic improvement was noted after 1 week. The 1-year follow-up was unremarkable. According to our knowledge and review of the literature, this is one of the few cases reported of vulvar herpes zoster, especially related to infliximab.
Topics: Adult; Female; Herpes Zoster; Herpesvirus 3, Human; Humans; Infliximab; Valacyclovir; Vulva
PubMed: 34972780
DOI: 10.1136/bcr-2021-246797 -
The Pan African Medical Journal 2021Gonorrhea is all diseases caused by Neisseria gonorrhoeae. Prepubertal child is more susceptible to N. gonorrhoeae infection because the vagina is alkaline and contains...
Gonorrhea is all diseases caused by Neisseria gonorrhoeae. Prepubertal child is more susceptible to N. gonorrhoeae infection because the vagina is alkaline and contains no estrogen. Gonorrhea vaginitis is the most common form of gonorrhoea in prepubertal children beyond neonatal period. Transmission in child can be through sexual contact (abuse) or non-sexual contact. Gonorrhea vaginitis in children more often asymptomatic, with clinical manifestation such as mucopurulent discharge, vaginal pruritus and vulval erythema. Supporting examination comprise of gram staining from vaginal discharge, culture and nucleic acid amplification testing (NAAT). Ceftriaxone is drug of choice gonorrhea without complication in children. We report a case of 4 year and 9-month female girl that was diagnosed by history taking and supporting examination from gram staining and polymerase chain reaction (PCR) from vaginal discharge, and then treated with single dose ceftriaxone 125 mg intramuscular that gave clinical improvement.
Topics: Anti-Bacterial Agents; Ceftriaxone; Child, Preschool; Female; Gonorrhea; Humans; Neisseria gonorrhoeae; Polymerase Chain Reaction; Vaginosis, Bacterial
PubMed: 34367437
DOI: 10.11604/pamj.2021.38.358.28390 -
BMC Infectious Diseases Jun 2021Multicentric intraepithelial lesions of the lower genital tract (multicentric lesions) were defined as intraepithelial lesions of two or three sites within cervix,...
BACKGROUND
Multicentric intraepithelial lesions of the lower genital tract (multicentric lesions) were defined as intraepithelial lesions of two or three sites within cervix, vagina, and vulva occurring synchronously or sequentially. The characteristics of multicentric lesions has been poorly understood. This study aimed to evaluate the risk factors for multicentric lesions, including specific HPV genotypes.
METHODS
A retrospective case-control study was performed involving patients histologically diagnosed with multicentric lesions between January 2018 and October 2019. Controls were patients histologically diagnosed with single cervical intraepithelial neoplasia (CIN) and admitted during the same period. Univariable and multivariable analyses were used to assess the risk factors for multicentric lesions.
RESULTS
Of 307 patients with multicentric lesions, the median age was 50 years (interquartile range: 43-55.5), and they were older than patients with single CIN (median age: 43 years, interquartile range: 36-50). In the multicentric lesion group, the proportions of cytologic abnormalities, HPV positivity, and multiple HPV infections were 68.9, 97.0, and 36.5%, respectively. In the multivariable analysis, menopause, a history of malignant tumors beyond the lower genital tract and multiple HPV infections were associated with the incidence of multicentric lesions (Odd ratio (OR) = 3.14, 95% confidence interval (CI) 2.24-4.41; OR = 9.58, 95% CI 1.02-89.84; OR = 1.47, 95% CI 1.03-2.10). The common HPV genotypes were HPV16, HPV53, HPV58, HPV52, HPV51, HPV56 and HPV18 in patients with multicentric lesions. The proportion of HPV16 infection was higher in high-grade lesions group than that in low-grade lesions group (OR = 2.54, 95% CI 1.34-4.83). The OR for multicentric lesions, adjusted for menopause, smoking, gravidity, parity, a history of malignant tumor beyond the lower genital tract and multiple HPV infection, was 1.97 (95% CI 1.04-3.75) in patients with HPV51 infection.
CONCLUSIONS
Multicentric lesions were associated with menopause, a history of malignant tumors and multiple HPV infections. HPV16 was the most common genotype, especially in high grade multicentric lesions and HPV51 infection was found to be a risk factor for detecting multicentric lesions.
Topics: Adult; Case-Control Studies; Female; Genital Neoplasms, Female; Humans; Middle Aged; Papillomaviridae; Papillomavirus Infections; Reproductive Tract Infections; Retrospective Studies; Risk Factors
PubMed: 34116658
DOI: 10.1186/s12879-021-06234-0 -
Acta Veterinaria Scandinavica Feb 2018The zoonotic Orf virus (ORFV; genus Parapoxvirus, Poxviridae family) occurs worldwide and is transmitted between sheep and goats, wildlife and man. Archived tissue...
BACKGROUND
The zoonotic Orf virus (ORFV; genus Parapoxvirus, Poxviridae family) occurs worldwide and is transmitted between sheep and goats, wildlife and man. Archived tissue samples from 16 Alaskan wildlife cases, representing mountain goat (Oreamnos americanus, n = 8), Dall's sheep (Ovis dalli dalli, n = 3), muskox (Ovibos moschatus, n = 3), Sitka black-tailed deer (Odocoileus hemionus sitkensis, n = 1) and caribou (Rangifer tarandus granti, n = 1), were analyzed.
RESULTS
Clinical signs and pathology were most severe in mountain goats, affecting most mucocutaneous regions, including palpebrae, nares, lips, anus, prepuce or vulva, as well as coronary bands. The proliferative masses were solid and nodular, covered by dark friable crusts. For Dall's sheep lambs and juveniles, the gross lesions were similar to those of mountain goats, but not as extensive. The muskoxen displayed ulcerative lesions on the legs. The caribou had two ulcerative lesions on the upper lip, as well as lesions on the distal part of the legs, around the main and dew claws. A large hairless spherical mass, with the characteristics of a fibroma, was sampled from a Sitka black-tailed deer, which did not show proliferative lesions typical of an ORFV infection. Polymerase chain reaction analyses for B2L, GIF, vIL-10 and ATI demonstrated ORFV specific DNA in all cases. Sequences from Dall's sheep formed a separate cluster, comparable to ORFV from domestic sheep. Sequences from the other species were different from the Dall's sheep sequences, but almost identical to each other.
CONCLUSIONS
This is the first major investigation of parapoxvirus infections in large Alaskan game species, and the first report of parapoxvirus infection in caribou and Sitka black-tailed deer. This study shows that most of the wild ruminant species in Alaska and from most parts of Alaska, can carry and be affected by ORFV. These findings call for attention to transmission of ORFV from wildlife to livestock and to hunters, subsistence harvesters, and wildlife biologists.
Topics: Animals; DNA, Viral; Deer; Ecthyma, Contagious; Orf virus; Reindeer; Ruminants; Sheep; Sheep Diseases
PubMed: 29467004
DOI: 10.1186/s13028-018-0366-8 -
Obstetrics and Gynecology Dec 2012In March 2012, the College of American Pathologists and American Society for Colposcopy and Cervical Pathology, in collaboration with 35 stakeholder organizations,...
In March 2012, the College of American Pathologists and American Society for Colposcopy and Cervical Pathology, in collaboration with 35 stakeholder organizations, convened a consensus conference called the Lower Anogenital Squamous Terminology (LAST) Project. The recommendations of this project include using a uniform, two-tiered terminology to describe the histology of human papillomavirus-associated squamous disease across all anogenital tract tissues: vulva, vagina, cervix, penis, perianus, and anus. The recommended terminology is "low-grade" or "high-grade squamous intraepithelial lesion (SIL)." This terminology is familiar to clinicians, because it parallels the terminology of the Bethesda System cytologic reports. Biopsy results using SIL terminology may be further qualified using "intraepithelial neoplasia" (IN) terminology in parentheses. Laboratory p16 tissue immunostaining is recommended to better classify histopathology lesions that morphologically would earlier have been diagnosed as IN 2. p16 is also recommended for differentiating between high-grade squamous intraepithelial lesions and benign mimics. The LAST Project recommendations potentially affect the application of current guidelines for managing cervical squamous intraepithelial lesions. The authors offer interim guidance for managing cervical lesions diagnosed using this new terminology with special attention paid to managing young women with cervical high-grade squamous intraepithelial lesions on biopsy. Clinicians should be aware of the LAST Project recommendations, which include important changes from prior terminology.
Topics: Cervix Uteri; Cyclin-Dependent Kinase Inhibitor p16; Female; Humans; Immunohistochemistry; Neoplasm Grading; Neoplasms, Squamous Cell; Papillomavirus Infections; Practice Guidelines as Topic; Uterine Cervical Neoplasms; Uterine Cervical Dysplasia
PubMed: 23168774
DOI: 10.1097/aog.0b013e31827001d5 -
Tropical Medicine & International... Jun 2009Bacterial vaginosis (BV) and Trichomonas vaginalis infection (TV) have been associated with adverse birth outcomes and increased risk for HIV. We compare the performance...
OBJECTIVE
Bacterial vaginosis (BV) and Trichomonas vaginalis infection (TV) have been associated with adverse birth outcomes and increased risk for HIV. We compare the performance of simple inexpensive point-of-care (POC) tests to laboratory diagnosis and syndromic management of BV and TV in poor settings.
METHODS
Between November 2005 and March 2006, 898 sexually active women attending two reproductive health clinics in Mysore, India were recruited into a cohort study investigating the relationship between vaginal flora and HSV-2 infection. Participants were interviewed and screened for reproductive tract infections. Laboratory tests included serology for HSV-2; cultures for TV, Candida sp., and Neisseria gonorrhoeae; Gram stains; and two POC tests: vaginal pH; and Whiff test.
RESULTS
Of the 898 participants, 411 [45.7%, 95% confidence interval (95% CI): 42.4-49.0%] had any laboratory diagnosed vaginal infection. BV was detected in 165 women (19.1%, 95%CI: 16.5-21.9%) using Nugent score. TV was detected in 76 women (8.5%, 95%CI: 6.7-10.4%) using culture. Among the entire study population, POC correctly detected 82% of laboratory diagnosed BV cases, and 83% of laboratory diagnosed TV infections. Among women with complaints of vulval itching, burning, abnormal vaginal discharge, and/or sores (445/898), POC correctly detected 83% (60 of 72 cases) of laboratory diagnosed BV cases vs. 40% (29 of 72 cases) correctly managed using the syndromic approach (P < 0.001). Similarly, POC would have detected 82% (37 of 45 cases) of TV cases vs. 51% (23 of 45 cases) correctly managed using the syndromic approach (P = 0.001).
CONCLUSIONS
In the absence of laboratory diagnostics, POC is not only inexpensive and practical, but also significantly more sensitive than the syndromic management approach, resulting in less overtreatment. .
Topics: Adolescent; Adult; Diagnostic Techniques, Obstetrical and Gynecological; Female; Humans; Hydrogen-Ion Concentration; India; Medically Underserved Area; Odorants; Point-of-Care Systems; Prospective Studies; Pruritus; Trichomonas Vaginitis; Vaginal Discharge; Vaginal Smears; Vaginosis, Bacterial; Young Adult
PubMed: 19392745
DOI: 10.1111/j.1365-3156.2009.02274.x -
Asian Pacific Journal of Cancer... 2016Vulva and Vaginal cancers are rare among all gynecological cancers worldwide, including Thailand, and typically affect women in later life. Persistent high risk human...
Vulva and Vaginal cancers are rare among all gynecological cancers worldwide, including Thailand, and typically affect women in later life. Persistent high risk human papillomavirus (HR-HPV) infection is one of several important causes of cancer development. In this study, we focused on HPV investigation and specific type distribution from Thai women with abnormality lesions and cancers of the vulva and Vaginal. A total of ninety paraffin-embedded samples of vulva and Vaginal abnormalities and cancer cells with histologically confirmed were collected from Thai women, who were diagnosed in 2003-2012 at the National Cancer Institute, Thailand. HPV DNA was detected and genotyped using polymerase chain reaction and enzyme immunoassay with GP5+/ bio 6+ consensus specific primers and digoxigenin-labeled specific oligoprobes, respectively. The human β-globin gene was used as an internal control. Overall results represented that HPV frequency was 16/34 (47.1%) and 8/20 (40.0%) samples of vulva with cancer and abnormal cytology lesions, respectively, while, 3/5 (60%) and 16/33 (51.61%) samples of Vaginal cancer and abnormal cytology lesions, respectively, were HPV DNA positive. Single HPV type and multiple HPV type infection could be observed in both type of cancers and abnormal lesion samples in the different histological categorizes. HPV16 was the most frequent type in all cancers and abnormal cytology lesions, whereas HPV 18 was less frequent and could be detected as co-infection with other high risk HPV types. In addition, low risk types such as HPV 6, 11 and 70 could be detected in Vulva cancer and abnormal cytology lesion samples, whereas, all Vaginal cancer samples exhibited only high risk HPV types; HPV 16 and 31. In conclusion, from our results in this study we suggest that women with persistent high risk HPV type infection are at risk of developing vulva and Vaginal cancers and HPV 16 was observed at the highest frequent both of these, similar to the cervical cancer cases. Although the number of samples in this study was limited and might not represent the overall incidence and prevalence in Thai women, but the baseline data are of interest and suggest further study for primary cancer screening and/or developing the efficiency of prophylactic HPV vaccines in Thailand.
Topics: Coinfection; DNA, Viral; Female; Humans; Middle Aged; Papillomaviridae; Papillomavirus Infections; Papillomavirus Vaccines; Thailand; Uterine Cervical Neoplasms; Vagina; Vaginal Neoplasms; Vaginal Smears; Vulva; Vulvar Neoplasms; Uterine Cervical Dysplasia
PubMed: 27039737
DOI: 10.7314/apjcp.2016.17.3.1129 -
Plant Disease May 2022is a problematic annual weed in rice fields and is widely distributed throughout tropical to warm temperate regions of the world. In June 2019, many galls were observed...
is a problematic annual weed in rice fields and is widely distributed throughout tropical to warm temperate regions of the world. In June 2019, many galls were observed on the roots of growing in rice fields in Heshan District, Hengyang City, Hunan Province, China. The infected plants did not exhibit obvious aboveground symptoms. Females, males, eggs, and second-stage juveniles (J2s) of spp. were found within galls after dissection. The perineal patterns of females were dorsoventrally oval shape with low and round dorsal archs, smooth striae, and lacking distinct lateral lines. Morphological measurements of females (n = 20) included body length (L) = 589.4 ± 64.7 (482.1 to 693.8) μm, body width (BW) = 362.2 ± 84.6 (267.6 to 505.9) μm, stylet = 11.7 ± 1.5 (9.7 to 14.4) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 3.8 ± 0.6 (3.3 to 5.0) μm, vulval slit length = 23.7 ± 4.4 (15.5 to 28.9) μm, vulval slit to anus distance = 16.8 ± 2.7 (13.1 to 19.4) μm. The J2s were vermiform and had a long and slender tail with tapering hyaline tail terminus. Measurements of J2s (n = 20) were L = 464.4 ± 31.7 (415.0 to 508.3) μm, BW = 16.9 ±1.7 (14.1 to 19.7) μm, stylet = 13.2 ± 0.6 (12.5 to 14.9) μm, DGO = 3.3 ± 0.5 (2.6 to 4.4) μm, tail = 71.6 ± 5.5 (65.1 to 82.0) μm, hyaline tail length = 19.4 ± 2.6 (15.3 to 23.9) μm. These morphological characteristics were similar to those previously described for (Golden and Birchfield 1965). Genomic DNA extracted from a single J2 was used for molecular identification. The ITS rRNA gene and the mtDNA COII-16S rRNA region were amplified using primers 18s/26s (TTGATTACGT CCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and C2F3/1108 (GGTCAATGT TCAGAAATTTGTGG/TACCTTTGACCAATCACGCT), respectively (Powers and Harris 1993; Vrain et al. 1992). Both the ITS rRNA gene sequence (790 bp, GenBank accession no. MZ656127) and the mtDNA COII-16S rRNA region sequence (531 bp, OM161973) showed 100% identity with sequences of (e.g., MN647593, MG773553, MF320126; MG356945, MH332687, JN241939). Furthermore, species identification was also further validated using the -specific primers SCAR-MgFW/SCAR-MgRev (GGGGAAGACATTTAATTGATGATCAAC/GGTACCGAAACTTAGGGAAAG) (Bellafiore et al. 2015). The PCR products yielded the expected fragment size of 640 bp, which was identical to that previously reported for (Bellafiore et al. 2015). To verify the pathogenicity of this nematode, 15 30-day-old seedlings planted in pots with sterilized soil were inoculated with 400 freshly hatched J2s from the original population of per plant, and five non-inoculated seedlings were used as controls. All plants were grown in a greenhouse at 26 to 28 °C with a 16 h light/8 h dark photoperiod. At 30 days after inoculation, all inoculated plants showed gall symptoms on the roots identical to those observed in the fields. The nematode reproduction factor (final population/initial population) was 12.6. No symptoms were observed on non-inoculated plants. These results confirmed the pathogenicity of on . To our knowledge, this is the first report of naturally infecting in China. is an alternative host of and could serve as a potential reservoir for in field. Therefore, weed management could be an effective way to reduce the disease by eliminating source of infection of .
PubMed: 35536213
DOI: 10.1094/PDIS-03-22-0695-PDN -
American Family Physician Apr 1998Bartholin gland cysts and abscesses are common problems in women of reproductive age. Although the cysts are usually asymptomatic, they may become enlarged or infected... (Review)
Review
Bartholin gland cysts and abscesses are common problems in women of reproductive age. Although the cysts are usually asymptomatic, they may become enlarged or infected and cause significant pain. Often the clinician is tempted simply to lance the cyst or abscess, since this technique can be effective for other common abscesses. However, simple lancing of a Bartholin gland cyst or abscess may result in recurrence. More effective treatment methods include use of a Word catheter and marsupialization, both of which can be performed in the office.
Topics: Abscess; Adenocarcinoma; Adult; Bartholin's Glands; Cysts; Diagnosis, Differential; Female; Humans; Pregnancy; Pregnancy Complications; Recurrence; Vulvar Diseases; Vulvovaginitis
PubMed: 9556648
DOI: No ID Found