-
Cutibacterium acnes (Propionibacterium acnes) and acne vulgaris: a brief look at the latest updates.Journal of the European Academy of... Jun 2018While the commensal bacterium Propionibacterium acnes (P. acnes) is involved in the maintenance of a healthy skin, it can also act as an opportunistic pathogen in acne... (Review)
Review
While the commensal bacterium Propionibacterium acnes (P. acnes) is involved in the maintenance of a healthy skin, it can also act as an opportunistic pathogen in acne vulgaris. The latest findings on P. acnes shed light on the critical role of a tight equilibrium between members of its phylotypes and within the skin microbiota in the development of this skin disease. Indeed, contrary to what was previously thought, proliferation of P. acnes is not the trigger of acne as patients with acne do not harbour more P. acnes in follicles than normal individuals. Instead, the loss of the skin microbial diversity together with the activation of the innate immunity might lead to this chronic inflammatory condition. This review provides results of the most recent biochemical and genomic investigations that led to the new taxonomic classification of P. acnes renamed Cutibacterium acnes (C. acnes), and to the better characterisation of its phylogenetic cluster groups. Moreover, the latest data on the role of C. acnes and its different phylotypes in acne are presented, providing an overview of the factors that could participate in the virulence and in the antimicrobial resistance of acne-associated strains. Overall, this emerging key information offers new perspectives in the treatment of acne, with future innovative strategies focusing on C. acnes biofilms and/or on its acne-associated phylotypes.
Topics: Acne Vulgaris; Humans; Propionibacterium acnes
PubMed: 29894579
DOI: 10.1111/jdv.15043 -
F1000Research 2018The skin commensal , recently renamed , along with the other major pathophysiological factors of increased seborrhea, hyperkeratinization of the pilosebaceous unit, and... (Review)
Review
The skin commensal , recently renamed , along with the other major pathophysiological factors of increased seborrhea, hyperkeratinization of the pilosebaceous unit, and inflammation, has long been implicated in the pathogenesis of acne. Recent advances have contributed to our understanding of the role of in acne. Although there are no quantitative differences in of the skin of patients with acne compared with controls, the phylogenic groups display distinct genetic and phenotypic characteristics, biofilms are more frequent in acne, and different phylotypes may induce distinct immune responses in acne. plays a further important role in the homeostasis of the skin's microbiome, interacting with other cutaneous commensal or pathogenic microorganisms such as , , and species. In the era of increasing antimicrobial resistance, the selection of acne treatment targeting and the prevention of antibiotic resistance play a key role in improving outcomes in acne patients and public health.
Topics: Acne Vulgaris; Animals; Biofilms; Drug Resistance, Microbial; Gram-Positive Bacterial Infections; Humans; Microbiota; Propionibacterium acnes; Skin
PubMed: 30613388
DOI: 10.12688/f1000research.15659.1 -
Trends in Microbiology Apr 2023
Topics: Propionibacterium acnes; Skin
PubMed: 36328874
DOI: 10.1016/j.tim.2022.10.006 -
Infection 1980In spite of considerable advances during the last years, classification and identification of Actinomycetaceae and Propionibacteriaceae still present major problems.... (Review)
Review
In spite of considerable advances during the last years, classification and identification of Actinomycetaceae and Propionibacteriaceae still present major problems. Uncertainties about the systematic position and taxonomic status of several genera and species, the lack of reliable distinguishing characteristics or use of inadequately adapted techniques of investigation interfere with both micribiological and clinical research and also with routine work in the diagnostic laboratory. Nevertheless, besides actinomycosis, an etiologically well defined suppurative infection, several other diseases and lesions such as lacrimal canaliculitis, caries and periodontal disease, inflammation following use of intrauterine pessaries, various types of abscess, septicaemia, and acne vulgaris have been attributed to the direct or indirect pathogenic effects of fermentative actinomycetes, propionibacteria, or eubacteria. Many questions concerning their individual pathogenicity and their pathomechanisms still remain to be answered, however.
Topics: Acne Vulgaris; Actinomycetaceae; Actinomycosis; Animals; Fermentation; Humans; Periodontal Diseases; Propionibacteriaceae; Propionibacterium acnes
PubMed: 6450169
DOI: 10.1007/BF01639868 -
International Journal of Medical... 2021Bacteria response to their environment by producing some compounds which are used in cosmetic and pharmaceutical applications. Some probiotics can regulate immune... (Randomized Controlled Trial)
Randomized Controlled Trial
Bacteria response to their environment by producing some compounds which are used in cosmetic and pharmaceutical applications. Some probiotics can regulate immune response and modulate the symptoms of several diseases. Bacteria affect skin response to skin care products. Bacteria are thought to play an important role in acne incidence, skin moisture, and nutrient metabolism, but only a few studies have focused on the extracts of in skin care. In this study, we identified that GMNL6 enhanced collagen synthesis and the gene expression of serine palmitoyltransferase small subunit A. Meanwhile, GMNL6 reduced the melanin synthesis, the biofilm of , and the proliferation of Information from clinical observation during the ointment for external face use in people displayed that the syndromes of skin moisture, skin color, spots, wrinkles, UV spots, and porphyrins were improved. The diversification of human skin microbiomes was affected by smearing the face of volunteers with -GMNL6. Understanding the potential mechanisms of the action of -GMNL6 in dermatologic conditions promotes the development of care products.
Topics: Adult; Animals; Biofilms; Cell Line, Tumor; Collagen; Female; Fibroblasts; Humans; Lactobacillus plantarum; Male; Mice; Microbiota; Middle Aged; Ointments; Probiotics; Propionibacteriaceae; Skin; Skin Care; Staphylococcus aureus; Treatment Outcome; Young Adult
PubMed: 33526970
DOI: 10.7150/ijms.51545 -
The New England Journal of Medicine Sep 2021
Topics: Anti-Bacterial Agents; Clavicle; Deglutition Disorders; Diagnosis, Differential; Female; Humans; Lemierre Syndrome; Lung; Pain; Propionibacteriaceae; Thrombocytopenia; Tomography, X-Ray Computed; Young Adult
PubMed: 34587389
DOI: 10.1056/NEJMimc2103214 -
The British Journal of Ophthalmology Feb 2009Propionibacteriaceae (Propioni) are anaerobic bacteria associated with human and animal infections. Present-day methods of diagnosis for Propioni are unsatisfactory due...
BACKGROUND
Propionibacteriaceae (Propioni) are anaerobic bacteria associated with human and animal infections. Present-day methods of diagnosis for Propioni are unsatisfactory due to a lack of sensitivity of culture, time required for culture results (3 to 14 days) and difficulties in interpreting SYBR Green real-time PCR results. The goal of this work was to validate a new rapid and sensitive test for the diagnosis of Propioni infections (endophthalmitis, corneal ulcers and others).
MATERIAL AND METHODS
DNA was extracted using the MagNA Pure isolation kit (Roche), and bacterial detection and quantification were carried out with a set of original primers and probe (5'ATACGTAGGGTGCGAGCGTTGTCC; 5'TGGTGTTCCTCCTGATATCTGCGC and [Amino C6+JOE]-GATCGCGTCGGAAGTGTAATCTTGGGG-Black Hole Quencher). The PCR cycling programme consisted of one cycle at 95 degrees C, 20 s and 45 cycles at 95 degrees C, 3 s and 30 s at 60 degrees C. DNA extraction yields were assessed in the same tube.
RESULTS
This test detects as few as 0.01 Equivalent PFU/microl Propioni in phosphate-buffered saline (PBS), aqueous humour, vitreous or cell suspensions. Propioni is detected as a single contaminant or mixed with other bacteria, fungi or human cells.
CONCLUSION
The new real-time PCR is able to detect 0.01 Eq/CFU microl of Propioni suspended in PBS, vitreous, aqueous humour and human cells in less than 1.30 h.
Topics: Aqueous Humor; Colony Count, Microbial; DNA, Bacterial; Eye Infections, Bacterial; Gram-Positive Bacterial Infections; Humans; Polymerase Chain Reaction; Propionibacterium acnes; Vitreous Body
PubMed: 18977791
DOI: 10.1136/bjo.2008.146639 -
International Journal of Systematic and... Nov 2023A floc-forming bacterial strain, designated HF-7, was isolated from the activated sludge of an industrial wastewater treatment plant in Hefei, PR China. Cells of this...
A floc-forming bacterial strain, designated HF-7, was isolated from the activated sludge of an industrial wastewater treatment plant in Hefei, PR China. Cells of this strain were Gram-stain-positive, catalase- and oxidase-negative, facultatively anaerobic, and rod-shaped. Growth occurred at 20-42 °C (optimum, 28 °C), at pH 5.5-10.5 (optimum, pH 7.5) and with 0-8.0 % (w/v) NaCl (optimum, 1 %). The major fatty acid was anteiso-C. The polar lipid profile contained phosphatidylglycerol, diphosphatidylglycerol and phosphatidylinositol. The DNA G+C content was 67 mol% from whole genomic sequence analysis. Based on the results of 16S rRNA gene sequence analysis, this strain should be assigned to the genus and is closely related to CAU 1319 (95.87 % similarity), IPBSL-7 (95.19 %) and Ben 106 (94.63 %) but separated from them by large distances in different phylogenetic trees. Based on whole genome analysis, the orthologous average nucleotide identity and DNA-DNA hybridization values against two of the closest relatives were 75.21-76.50 % and 14.2-24.4 %, respectively. The phylogenetic, genotypic, phenotypic and chemotaxonomic data demonstrated that strain HF-7 could be distinguished from its phylogenetically related species and represents a novel species within the genus , for which the name sp. nov. is proposed. The type strain is HF-7 (=KCTC 49959=CCTCC AB 2023019).
Topics: Fatty Acids; Sewage; Phylogeny; RNA, Ribosomal, 16S; DNA, Bacterial; Sequence Analysis, DNA; Base Composition; Bacterial Typing Techniques; China; Propionibacteriaceae; Phospholipids
PubMed: 37990978
DOI: 10.1099/ijsem.0.006113 -
FEMS Microbiology Letters Jul 1989The effect of tetracyclines on the synthesis of proteins in Propionibacterium avidum and P. acnes was examined. Synthesis of an extracellular lipase by P. avidum was...
The effect of tetracyclines on the synthesis of proteins in Propionibacterium avidum and P. acnes was examined. Synthesis of an extracellular lipase by P. avidum was slightly more sensitive to inhibition by tetracycline than total (cellular and extracellular) protein synthesis. The effect of tetracycline and other analogues on the synthesis of secreted proteins was also examined in P. avidum and P. acnes by protein radiolabelling experiments. In all cases the synthesis of secreted proteins was only about 2-fold more sensitive to inhibition by tetracyclines than total protein synthesis. These results contrast with previously published findings in Escherichia coli which show that synthesis of secreted proteins is highly susceptible to inhibition by tetracycline. The implications of these findings in relation to inhibition of membrane bound ribosomes by tetracyclines are discussed.
Topics: Bacterial Proteins; Lipase; Propionibacteriaceae; Tetracyclines
PubMed: 2792736
DOI: 10.1016/0378-1097(89)90070-0 -
International Journal of Systematic and... Aug 2019The taxonomic position of an actinobacterium isolated from a desert soil sample collected from Badain Jaran Desert, designated as CPCC 204711, was established using a...
The taxonomic position of an actinobacterium isolated from a desert soil sample collected from Badain Jaran Desert, designated as CPCC 204711, was established using a polyphasic approach. Cells of the isolate were Gram-staining-positive, aerobic, non-motile cocci. Good growth was observed at 28 °C (range 20-40 °C), pH 7.0 (range pH 6.0-8.0) and 0-1 % NaCl concentration (range 0-5 %, w/v). Galactose, arabinose and ribose were detected as the sugar compositions in the whole cell hydrolysates. The peptidoglycan type was A3gamma (ll-Dpm-Gly). MK-9(H4) was detected as the predominant menaquinone, and diphosphatidylglycerol, phosphatidylglycerol, phosphatidylcholine, several unidentified glycolipids, and one unidentified amino-glycolipid were detected as the major polar lipids. The predominant fatty acid was anteiso-C15 : 0. The genomic DNA G+C content was 73.1 mol%. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain CPCC 204711 affiliated to the family Propionibacteriaceae, in which the strain formed a distinct phylogenetic lineage next to the genus Mariniluteicoccus, with the highest 16S rRNA gene sequence similarity of 96.0 % to Mariniluteicoccus endophyticus YIM 2617. Both phylogenetic analysis and phenotypic characteristics supported that strain CPCC 204711 represents a novel species of a new genus in the family Propionibacteriaceae, for which the name Desertihabitans aurantiacus gen. nov., sp. nov. is proposed, with CPCC 204711 (=KCTC 39977=DSM 105431) as the type strain.
Topics: Bacterial Typing Techniques; Base Composition; Cell Wall; China; DNA, Bacterial; Desert Climate; Diaminopimelic Acid; Fatty Acids; Glycolipids; Peptidoglycan; Phospholipids; Phylogeny; Propionibacteriaceae; RNA, Ribosomal, 16S; Sequence Analysis, DNA; Soil Microbiology; Vitamin K 2
PubMed: 31169487
DOI: 10.1099/ijsem.0.003519