-
Polymers Nov 2023The treatment and reuse of wastewater are crucial for the effective utilization and protection of global water resources. Polycyclic aromatic hydrocarbons (PAHs), as one...
The treatment and reuse of wastewater are crucial for the effective utilization and protection of global water resources. Polycyclic aromatic hydrocarbons (PAHs), as one of the most common organic pollutants in industrial wastewater, are difficult to remove due to their relatively low solubility and bioavailability in the water environment. However, biosurfactants with both hydrophilic and hydrophobic groups are effective in overcoming these difficulties. Therefore, a biosurfactant-producing strain MP-6 was isolated in this study to enhance the bioavailability and biodegradation of PAHs, especially high-molecular-weight PAHs (HMW-PAHs). FTIR and LC-MS analysis showed that the MP-6 surfactant belongs to rhamnolipids, a type of biopolymer, which can reduce the water surface tension from 73.20 mN/m to 30.61 mN/m at a critical micelle concentration (CMC = 93.17 mg/L). The enhanced solubilization and biodegradation of PAHs, particularly HMW-PAHs (when MP-6 was introduced), were also demonstrated in experiments. Furthermore, comprehensive environmental stress tolerance tests were conducted to confirm the robustness of the MP-6 biosurfactant, which signifies the potential adaptability and applicability of this biosurfactant in diverse environmental remediation scenarios. The results of this study, therefore, have significant implications for future applications in the treatment of wastewater containing HMW-PAHs, such as coking wastewater.
PubMed: 38232027
DOI: 10.3390/polym15234571 -
Toxics Dec 2023The use of bacteria of the genus -destructors of persistent pollutants for biotechnologies of environmental purification-is an interesting area of research. The aim of...
The use of bacteria of the genus -destructors of persistent pollutants for biotechnologies of environmental purification-is an interesting area of research. The aim of this work was to study the potential of strain 5(3) isolated from pesticide-contaminated soil as a degrader of C-C perfluorocarboxylic acids (PFCAs) and analyze its complete genome. The genome of the strain has been fully sequenced. It consists of a chromosome with a length of 5,676,241 b.p. and containing a total of 5134 genes, in particular, haloalkane dehalogenase gene (), haloacetate dehalogenase H-1 gene (), fluoride ion transporter gene () and alkanesulfonate monooxygenase gene (), responsible for the degradation of fluorinated compounds. The strain 5(3) for was cultivated for 7 days in a liquid medium with various C-C PFCAs as the sole source of carbon and energy, and completely disposed of them. The results of LC-MS analysis showed that the transformation takes place due to perfluorohexanoic acid with the release of various levels of stoichiometry (depending on PFCA) of fluorine ion mineralization indicators determined by ion chromatography. Thus, strain 5(3) demonstrates a genetically confirmed high potential for the decomposition of C-C PFCA.
PubMed: 38133402
DOI: 10.3390/toxics11121001 -
Microbiology Resource Announcements Dec 2023The P 5(3) strain is a potential degrader of persistent perfluorinated pollutants, particularly C-C perfluorinated acids. The genome of the strain has been fully...
The P 5(3) strain is a potential degrader of persistent perfluorinated pollutants, particularly C-C perfluorinated acids. The genome of the strain has been fully sequenced. It consists of a chromosome with a length of 5,676,241 base pairs and a G-C content of 64.38%.
PubMed: 37955621
DOI: 10.1128/MRA.00839-23 -
Nature Communications Feb 2023Natural products largely produced by Pseudomonads-like soil-dwelling microorganisms are a consistent source of antimicrobial metabolites and pesticides. Herein we report...
Natural products largely produced by Pseudomonads-like soil-dwelling microorganisms are a consistent source of antimicrobial metabolites and pesticides. Herein we report the isolation of Pseudomonas mosselii strain 923 from rice rhizosphere soils of paddy fields, which specifically inhibit the growth of plant bacterial pathogens Xanthomonas species and the fungal pathogen Magnaporthe oryzae. The antimicrobial compound is purified and identified as pseudoiodinine using high-resolution mass spectra, nuclear magnetic resonance and single-crystal X-ray diffraction. Genome-wide random mutagenesis, transcriptome analysis and biochemical assays define the pseudoiodinine biosynthetic cluster as psdABCDEFG. Pseudoiodinine biosynthesis is proposed to initiate from guanosine triphosphate and 1,6-didesmethyltoxoflavin is a biosynthetic intermediate. Transposon mutagenesis indicate that GacA is the global regulator. Furthermore, two noncoding small RNAs, rsmY and rsmZ, positively regulate pseudoiodinine transcription, and the carbon storage regulators CsrA2 and CsrA3, which negatively regulate the expression of psdA. A 22.4-fold increase in pseudoiodinine production is achieved by optimizing the media used for fermentation, overexpressing the biosynthetic operon, and removing the CsrA binding sites. Both of the strain 923 and purified pseudoiodinine in planta inhibit the pathogens without affecting the rice host, suggesting that pseudoiodinine can be used to control plant diseases.
Topics: Bacterial Proteins; Pseudomonas; RNA, Untranslated; Operon; Plant Diseases; Oryza
PubMed: 36759518
DOI: 10.1038/s41467-023-36433-z -
Antibiotics (Basel, Switzerland) Nov 2022The emergence of drug resistant microbes over recent decades represents one of the greatest threats to human health; the resilience of many of these organisms can be...
The emergence of drug resistant microbes over recent decades represents one of the greatest threats to human health; the resilience of many of these organisms can be attributed to their ability to produce biofilms. Natural products have played a crucial role in drug discovery, with microbial natural products in particular proving a rich and diverse source of antimicrobial agents. During antimicrobial activity screening, the strain P33 was found to inhibit the growth of multiple pathogens. Following chemical investigation of this strain, pseudopyronines A-C were isolated as the main active principles, with all three pseudopyronines showing outstanding activity against . The analogue pseudopyronine C, which has not been well-characterized previously, displayed sub-micromolar activity against , and . Moreover, the inhibitory abilities of the pseudopyronines against the biofilms of were further studied. The results indicated all three pseudopyronines could directly reduce the growth of biofilm in both adhesion stage and maturation stage, displaying significant activity at micromolar concentrations.
PubMed: 36421300
DOI: 10.3390/antibiotics11111655 -
Biology Aug 2022The environmental bacterium produces antagonistic secondary metabolites with inhibitory effects on multiple plant pathogens, including the causal agent of bacterial...
The environmental bacterium produces antagonistic secondary metabolites with inhibitory effects on multiple plant pathogens, including the causal agent of bacterial wilt. In this study, an engineered strain was generated to express , which determines the incompatible interactions with tobacco plants. The gene, together with its native promoter, was integrated into the chromosome. The resulting strain showed no difference in antimicrobial activity against . Promoter-LacZ fusion and RT-PCR experiments demonstrated that the gene was transcribed in culture media. Compared with that of the wild type, the engineered strain reduced the disease index by 9.1% for bacterial wilt on tobacco plants. A transcriptome analysis was performed to identify differentially expressed genes in tobacco plants, and the results revealed that ethylene- and jasmonate-dependent defense signaling pathways were induced. These data demonstrates that the engineered expressing can improve biological control against tobacco bacterial wilt by the activation of host defense responses.
PubMed: 36009798
DOI: 10.3390/biology11081170 -
Evidence-based Complementary and... 2022is a traditional Chinese medicine for treating gastrointestinal diseases by nourishing "Yin" and thickening the stomach lining. To study whether endophytes can...
is a traditional Chinese medicine for treating gastrointestinal diseases by nourishing "Yin" and thickening the stomach lining. To study whether endophytes can colonize the intestinal tract and regulate gut microbiota in mice, we used autoclave steam sterilizing and Co- radiation to eliminate endophytes from its juice. Then, high-throughput ITS1-ITS2 rDNA and 16S rRNA gene amplicons were sequenced to analyze the microbial community of endophytes and fecal samples of mice after administration of fresh juice. Sterilization of juice by autoclaving for 40 min (ASDO40) could more effectively eliminate the endophytes and decrease their interference on the gut microbiota. juice could increase beneficial gut microbiota and metabolites including short-chain fatty acids. endophytes , , s, , and could colonize the intestinal tract of mice and modulate gut microbiota after oral administration of the juice for 28 days. Thus, the regulatory effect of juice on gut microbiota was observed, which provides a basis for inferring that endophytes might colonize the intestinal tract and participate in regulating gut microbiota to treat diseases. Thus, this study further provides a new approach for the treatment of diseases by colonizing plant endophytes in the intestinal tract and regulating gut microbiota.
PubMed: 35990847
DOI: 10.1155/2022/2607506 -
Microbiology Spectrum Aug 2022Asian rice is one of the most important crops because it is a staple food for almost half of the world's population. To have production of rice keep pace with a growing...
Asian rice is one of the most important crops because it is a staple food for almost half of the world's population. To have production of rice keep pace with a growing world population, it is anticipated that the use of fertilizers will also need to increase, which may cause environmental damage through runoff impacts. An alternative strategy to increase crop yield is the use of plant growth-promoting bacteria. Thousands of microbial species can exist in association with plant roots and shoots, and some are critical to the plant's survival. We isolated 140 bacteria from two distantly related rice accessions and investigated whether their impact on the growth of four different rice accessions. The bacterial isolates were screened for their ability to solubilize phosphate, a known plant growth-promoting characteristic, and 25 isolates were selected for further analysis. These 25 phosphate-solubilizing isolates were also able to produce other potentially growth-promoting factors. Five of the most promising bacterial isolates were chosen for whole-genome sequencing. Four of these bacteria, isolates related to Pseudomonas mosselii, a sp., Paenibacillus rigui, and Paenibacillus graminis, improved root and shoot growth in a rice genotype-dependent manner. This indicates that while bacteria have several known plant growth-promoting functions, their effects on growth parameters are rice genotype dependent and suggest a close relationship between plants and their microbial partners. In this study, endophytic bacterial isolates from roots and shoots of two distantly related rice accessions were characterized phenotypically and genotypically. From the isolated bacterial species, five of the most promising plant growth-promoting bacteria were selected to test their abilities to enhance growth of the four rice accessions. Interestingly, plant growth enhancement was both bacterial isolate specific and plant genotype specific. However, the positive interactions between plant and bacteria could not easily be predicted because rice growth-promoting bacteria isolated from their host plants did not necessarily stimulate growth of their own host.
Topics: Genotype; Oryza; Phosphates; Plant Roots
PubMed: 35862989
DOI: 10.1128/spectrum.02787-21 -
First report of Pseudomonas mosselii causing white blotch disease in Pleurotus pulmonarius in China.Plant Disease Jul 2022Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P....
Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P. pulmonarius, growing in a mushroom farm in Nanning, China. Initially, white blotch (0.7-1.6 cm) appeared on the cap of the young P. pulmonarius, which expanded gradually as the cap grew. However, the fruiting bodies still grew well without rotting. The pathogen causing this phenomenon was isolated from infected cap tissues using a dilution plate technique, sections of tissue (approximately 5×5×5 mm) with white blotch were rinsed three times in sterile deionized water, then, mashed in the sterile 2 ml eppendorf tubes, 1000µl sterile water was added and the suspension was diluted into eight concentrations (10-1~10-8). From each concentration, 120µl suspension was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28°C. Both 10-5 and 10-6 suspensions had single colonies, the dominant single colonies were picked and purified 2-3 times. The purified colonies were round, beige, and opaque, with a raised center and regular, smooth and moist margins. This bacterium is gram negative, short rod-shaped, single polar flagellum, motile, without pods or endospores, and produced fluorescent pigments on King's B medium. Amplified 16S rDNA (1396 bp; OM022022) of four randomly selected colonies using universal primers 27f/1492r, exhibited 100% identity with Pseudomonas (Ps.) mosselii. The partial sequences of the rpoB (1173bp; OM202622), rpoD (734bp; ON469579), gyrB (1383bp; OM202621) and recA (887bp; ON469580) genes of four selected colonies were amplified using primers LAPS5/LAFS27(Tayeb et al. 2005.), PsEG30F/PsEG790R (Mulet et al. 2009), gyrB-R/gyrB-F (Agaras et al. 2018) and recA-F (5'-3' ACGACAACAAGAAGCGCGCCTT)/recA-R (5'-3' CAATGGCCGGGTTCTCTTGCAGGTA) designed in this study, respectively, also exhibited 99%~100% similarities to Ps. mosselii. Phylogenetic analysis showed that isolates cluster with Ps. mosselii. The biochemical tests for isolates were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ps. mosselii (Positive for arginine dihydrolase, trisodium citrate, urea, lysine, arginine, ornithine and gelatin. Negative for glucosamine, lactose, galactose, rhamnose, maltose, sucrose, arabinose, mannose, xylose, esculoside, inositol, nitrate reduction and malonate) (Dabboussi et al.2002; Soto-Rodriguez et al. 2013). The isolates were identified as Ps. mosselii based on biochemical tests and phylogenetic analysis. This isolate was incubated in LB Broth at 28℃, 160 rpm for 24h and the bacterial cells were collected by centrifugation at 4000 rpm for 10min. The collected bacterial cells were resuspended in sterile deionized water to make a bacterial suspension. For pathogenicity tests, 30µl of bacterial suspension (approximately 1x10^9 CFU/mL) was added to the surface of the cap (3-4cm) of young P. pulmonarius. Sterile deionized water was added as a negative control. All treatments were incubated at 22°C and 80-85% humidity. The experiment was repeated three times with three bags each time. 12 h later, white blotches were visible on all parts of the inoculated mushroom. This disease symptoms were similar to those observed in the original samples. However, no disease phenomena were observed in the negative control group. After the pathogenicity test, we obtained the same pathogen as the initially isolates from infected tissues based on morphological characteristics, 16S rDNA sequences, rpoB, rpoD, gyrB and recA sequences, and biochemical test results. Ps. mosselii was first isolated clinically and described by Dabboussi et al. (2002). It has shown to be pathogenic to Oreochromis niloticus and humans (Soto-Rodriguez et al. 2013; Peña et al. 2019; Leneveu-Jenvrin et al. 2013; Huang et al. 2018.). However, to the best of our knowledge, this is the first report of Ps. mosselii causing white blotch disease in P. pulmonarius worldwide, which negatively affects the commercial value of P. pulmonarius and requires attention of mushroom industry.
PubMed: 35822894
DOI: 10.1094/PDIS-01-22-0201-PDN -
Frontiers in Microbiology 2022K17, an indigenous and heterotrophic nitrifying-aerobic denitrifying bacterium, was isolated from the soil of a weathered crust elution-deposited rare earth ore leaching...
K17, an indigenous and heterotrophic nitrifying-aerobic denitrifying bacterium, was isolated from the soil of a weathered crust elution-deposited rare earth ore leaching site in Longnan County, China. Strain K17 was identified as . In this study, the morphological characteristics of strain K17 were observed and the optimal ammonia nitrogen removal conditions for the strain were studied using a single-factor experiment. Key enzyme activities were determined, and we also explored the ammonia nitrogen removal process of strain K17 on simulated leaching liquor of the rare earth element leaching site. Based on the determination of ammonia nitrogen removal and enzyme activity, it was found that strain K17 has both heterotrophic nitrifying and aerobic denitrifying activities. In addition, single-factor experiments revealed that the most appropriate carbon source for strain K17 was sodium citrate with a C/N ratio of 10 and an initial NH -N concentration of 100 mg/l. Furthermore, the optimal initial pH and rotation speed were 7 and 165 r/min, respectively. Under optimal conditions, the ammonia nitrogen removal efficiency of strain K17 was greater than 95%. As an indigenous bacterium, strain K17 has great potential for treating residual ammonium leaching solutions from rare earth element leaching sites.
PubMed: 35756011
DOI: 10.3389/fmicb.2022.905409