-
Polymers Nov 2023The treatment and reuse of wastewater are crucial for the effective utilization and protection of global water resources. Polycyclic aromatic hydrocarbons (PAHs), as one...
The treatment and reuse of wastewater are crucial for the effective utilization and protection of global water resources. Polycyclic aromatic hydrocarbons (PAHs), as one of the most common organic pollutants in industrial wastewater, are difficult to remove due to their relatively low solubility and bioavailability in the water environment. However, biosurfactants with both hydrophilic and hydrophobic groups are effective in overcoming these difficulties. Therefore, a biosurfactant-producing strain MP-6 was isolated in this study to enhance the bioavailability and biodegradation of PAHs, especially high-molecular-weight PAHs (HMW-PAHs). FTIR and LC-MS analysis showed that the MP-6 surfactant belongs to rhamnolipids, a type of biopolymer, which can reduce the water surface tension from 73.20 mN/m to 30.61 mN/m at a critical micelle concentration (CMC = 93.17 mg/L). The enhanced solubilization and biodegradation of PAHs, particularly HMW-PAHs (when MP-6 was introduced), were also demonstrated in experiments. Furthermore, comprehensive environmental stress tolerance tests were conducted to confirm the robustness of the MP-6 biosurfactant, which signifies the potential adaptability and applicability of this biosurfactant in diverse environmental remediation scenarios. The results of this study, therefore, have significant implications for future applications in the treatment of wastewater containing HMW-PAHs, such as coking wastewater.
PubMed: 38232027
DOI: 10.3390/polym15234571 -
Antibiotics (Basel, Switzerland) Nov 2022The emergence of drug resistant microbes over recent decades represents one of the greatest threats to human health; the resilience of many of these organisms can be...
The emergence of drug resistant microbes over recent decades represents one of the greatest threats to human health; the resilience of many of these organisms can be attributed to their ability to produce biofilms. Natural products have played a crucial role in drug discovery, with microbial natural products in particular proving a rich and diverse source of antimicrobial agents. During antimicrobial activity screening, the strain P33 was found to inhibit the growth of multiple pathogens. Following chemical investigation of this strain, pseudopyronines A-C were isolated as the main active principles, with all three pseudopyronines showing outstanding activity against . The analogue pseudopyronine C, which has not been well-characterized previously, displayed sub-micromolar activity against , and . Moreover, the inhibitory abilities of the pseudopyronines against the biofilms of were further studied. The results indicated all three pseudopyronines could directly reduce the growth of biofilm in both adhesion stage and maturation stage, displaying significant activity at micromolar concentrations.
PubMed: 36421300
DOI: 10.3390/antibiotics11111655 -
Nature Communications Feb 2023Natural products largely produced by Pseudomonads-like soil-dwelling microorganisms are a consistent source of antimicrobial metabolites and pesticides. Herein we report...
Natural products largely produced by Pseudomonads-like soil-dwelling microorganisms are a consistent source of antimicrobial metabolites and pesticides. Herein we report the isolation of Pseudomonas mosselii strain 923 from rice rhizosphere soils of paddy fields, which specifically inhibit the growth of plant bacterial pathogens Xanthomonas species and the fungal pathogen Magnaporthe oryzae. The antimicrobial compound is purified and identified as pseudoiodinine using high-resolution mass spectra, nuclear magnetic resonance and single-crystal X-ray diffraction. Genome-wide random mutagenesis, transcriptome analysis and biochemical assays define the pseudoiodinine biosynthetic cluster as psdABCDEFG. Pseudoiodinine biosynthesis is proposed to initiate from guanosine triphosphate and 1,6-didesmethyltoxoflavin is a biosynthetic intermediate. Transposon mutagenesis indicate that GacA is the global regulator. Furthermore, two noncoding small RNAs, rsmY and rsmZ, positively regulate pseudoiodinine transcription, and the carbon storage regulators CsrA2 and CsrA3, which negatively regulate the expression of psdA. A 22.4-fold increase in pseudoiodinine production is achieved by optimizing the media used for fermentation, overexpressing the biosynthetic operon, and removing the CsrA binding sites. Both of the strain 923 and purified pseudoiodinine in planta inhibit the pathogens without affecting the rice host, suggesting that pseudoiodinine can be used to control plant diseases.
Topics: Bacterial Proteins; Pseudomonas; RNA, Untranslated; Operon; Plant Diseases; Oryza
PubMed: 36759518
DOI: 10.1038/s41467-023-36433-z -
Journal of Applied Microbiology Sep 2013To identify bacterial pathogens of diseased NiIe tilapia Oreochromis niloticus and determine their virulence.
Identification and virulence of Aeromonas dhakensis, Pseudomonas mosselii and Microbacterium paraoxydans isolated from Nile tilapia, Oreochromis niloticus, cultivated in Mexico.
AIMS
To identify bacterial pathogens of diseased NiIe tilapia Oreochromis niloticus and determine their virulence.
METHODS AND RESULTS
Sixteen bacterial isolates were recovered from diseased Nile tilapias (O. niloticus) reared in floating cages in Adolfo Lopez Mateos (ALM), Sanalona and Dique IV dams in Sinaloa, Mexico, from February to May 2009. The bacterial isolates were identified by phenotypic and molecular (rep-PCR and 16S rRNA sequencing) methods and were mostly isolated from the kidneys and the brain of tilapias. Bacterial cells and extracellular products (ECPs) of strains were characterized and used in experimental infections with sole Solea vulgaris and Mozambican tilapia Oreochromis mossambicus. The fish challenged with Aeromonas dhakensis sp. nov. comb nov, Pseudomonas mosselii and Microbacterium paraoxydans (3·1 × 10(6) CFU g(-) 1) exhibited mortality between 40 and 100% starting at 6 h postinoculation. The ECPs displayed gelatinase, haemolytic and cytotoxic activity, causing the total destruction of the HeLa cell lines.
CONCLUSIONS
Aeromonas dhakensis and Ps. mosselii were virulent to O. mossambicus, whereas Mic. paraoxydans displayed virulence to S. vulgaris.
SIGNIFICANCE AND IMPACT OF THE STUDY
This the first time that Aeromonas dhakensis and Ps. mosselii are reported as pathogens to tilapia and Mic. paraoxydans was isolated from fish; then, these fish pathogens could be a threat to farmed Nile tilapia in Mexico.
Topics: Actinomycetales; Aeromonas; Animals; Cichlids; Fish Diseases; HeLa Cells; Humans; Mexico; Pseudomonas; RNA, Ribosomal, 16S; Virulence
PubMed: 23758410
DOI: 10.1111/jam.12280 -
Frontiers in Microbiology 2016In continuation of our search for new bioactive compounds from soil microbes, a fluorescent Pseudomonas strain isolated from paddy field soil of Kuttanad, Kerala, India...
In continuation of our search for new bioactive compounds from soil microbes, a fluorescent Pseudomonas strain isolated from paddy field soil of Kuttanad, Kerala, India was screened for the production of bioactive secondary metabolites. This strain was identified as Pseudomonas mosselii through 16S rDNA gene sequencing followed by BLAST analysis and the bioactive metabolites produced were purified by column chromatography (silica gel) and a pure bioactive secondary metabolite was isolated. This bioactive compound was identified as Pseudopyronine B by NMR and HR-ESI-MS. Pseudopyronine B recorded significant antimicrobial activity especially against Gram-positive bacteria and agriculturally important fungi. MTT assay was used for finding cell proliferation inhibition, and Pseudopyronine B recorded significant antitumor activity against non-small cell lung cancer cell (A549), and mouse melanoma cell (B16F10). The preliminary MTT assay results revealed that Pseudopyronine B recorded both dose- and time-dependent inhibition of the growth of test cancer cell lines. Pseudopyronine B induced apoptotic cell death in cancer cells as evidenced by Acridine orange/ethidium bromide and Hoechst staining, and this was further confirmed by flow cytometry analysis using Annexin V. Cell cycle analysis also supports apoptosis by inducing G2/M accumulation in both A549 and B16F10 cells. Pseudopyronine B treated cells recorded significant up-regulation of caspase 3 activity. Moreover, this compound recorded immunomodulatory activity by enhancing the proliferation of lymphocytes. The production of Pseudopyronine B by P. mosselii and its anticancer activity in A549 and B16F10 cell lines is reported here for the first time. The present study has a substantial influence on the information of Pseudopyronine B from P. mosselii as potential sources of novel drug molecule for the pharmaceutical companies, especially as potent antimicrobial and anticancer agent.
PubMed: 27617005
DOI: 10.3389/fmicb.2016.01307 -
BMC Microbiology May 2013The genus Pseudomonas includes a heterogeneous set of microorganisms that can be isolated from many different niches and nearly 100 different strains have been... (Comparative Study)
Comparative Study
BACKGROUND
The genus Pseudomonas includes a heterogeneous set of microorganisms that can be isolated from many different niches and nearly 100 different strains have been described. The best characterized bacterium is Pseudomonas aeruginosa which is the primary agent of opportunistic infection in humans, causing both acute and chronic infections. Other species like fluorescens, putida or mosselii have been sporadically isolated from hospitalized patients but their association with the pathology often remains unclear.
RESULTS
This study focuses on the cytotoxicity and inflammatory potential of two strains of Pseudomonas mosselii (ATCC BAA-99 and MFY161) that were recently isolated from clinical samples of hospitalized patients. The behavior of these bacteria was compared to that of the well-known opportunistic pathogen P. aeruginosa PAO1. We found that P. mosselii ATCC BAA-99 and MFY161 are cytotoxic towards Caco-2/TC7 cells, have low invasive capacity, induce secretion of human β-defensin 2 (HBD-2), alter the epithelial permeability of differentiated cells and damage the F-actin cytoskeleton.
CONCLUSIONS
These data bring new insights into P. mosselii virulence, since this bacterium has often been neglected due to its rare occurrence in hospital.
Topics: Actins; Bacterial Toxins; Cell Line; Cell Membrane Permeability; Endocytosis; Epithelial Cells; Hospitals; Humans; Pseudomonas; Pseudomonas Infections; Virulence; beta-Defensins
PubMed: 23718251
DOI: 10.1186/1471-2180-13-123 -
Toxics Dec 2023The use of bacteria of the genus -destructors of persistent pollutants for biotechnologies of environmental purification-is an interesting area of research. The aim of...
The use of bacteria of the genus -destructors of persistent pollutants for biotechnologies of environmental purification-is an interesting area of research. The aim of this work was to study the potential of strain 5(3) isolated from pesticide-contaminated soil as a degrader of C-C perfluorocarboxylic acids (PFCAs) and analyze its complete genome. The genome of the strain has been fully sequenced. It consists of a chromosome with a length of 5,676,241 b.p. and containing a total of 5134 genes, in particular, haloalkane dehalogenase gene (), haloacetate dehalogenase H-1 gene (), fluoride ion transporter gene () and alkanesulfonate monooxygenase gene (), responsible for the degradation of fluorinated compounds. The strain 5(3) for was cultivated for 7 days in a liquid medium with various C-C PFCAs as the sole source of carbon and energy, and completely disposed of them. The results of LC-MS analysis showed that the transformation takes place due to perfluorohexanoic acid with the release of various levels of stoichiometry (depending on PFCA) of fluorine ion mineralization indicators determined by ion chromatography. Thus, strain 5(3) demonstrates a genetically confirmed high potential for the decomposition of C-C PFCA.
PubMed: 38133402
DOI: 10.3390/toxics11121001 -
Access Microbiology 2019is the bacterial genus of Gram-negative bacteria with the highest number of recognized species. It is divided phylogenetically into three lineages and at least 11...
is the bacterial genus of Gram-negative bacteria with the highest number of recognized species. It is divided phylogenetically into three lineages and at least 11 groups of species. The group of species is one of the most versatile and best studied. It comprises 15 species with validly published names. As a part of the Genomic Encyclopedia of Bacteria and Archaea (GEBA) project, we present the genome sequences of the type strains of five species included in this group: (DSM 14164), (DSM 17497), (DSM 15088) (DSM 21245) and (DSM 16006). These strains represent species of environmental and also of clinical interest due to their pathogenic properties against humans and animals. Some strains of these species promote plant growth or act as plant pathogens. Their genome sizes are among the largest in the group, ranging from 5.3 to 6.3 Mbp. In addition, the genome sequences of the type strains in the taxonomy were analysed via genome-wide taxonomic comparisons of ANIb, gANI and GGDC values among 130 strains classified within the group. The results demonstrate that at least 36 genomic species can be delineated within the phylogenetic group of species.
PubMed: 32974501
DOI: 10.1099/acmi.0.000067 -
Genome Announcements Nov 2016Pseudomonas mosselii Gil3 was isolated from a catfish that survived from lethal challenge with hypervirulent Aeromonas hydrophila (vAh). When assayed in vitro, the...
Pseudomonas mosselii Gil3 was isolated from a catfish that survived from lethal challenge with hypervirulent Aeromonas hydrophila (vAh). When assayed in vitro, the bacterium showed antagonism against vAh. Sequence analysis revealed that the genome of P. mosselii Gil3 encodes numerous aromatic metabolism pathways and proteins for biosynthesis of antimicrobial compounds.
PubMed: 27856595
DOI: 10.1128/genomeA.01305-16 -
First report of Pseudomonas mosselii causing white blotch disease in Pleurotus pulmonarius in China.Plant Disease Jul 2022Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P....
Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P. pulmonarius, growing in a mushroom farm in Nanning, China. Initially, white blotch (0.7-1.6 cm) appeared on the cap of the young P. pulmonarius, which expanded gradually as the cap grew. However, the fruiting bodies still grew well without rotting. The pathogen causing this phenomenon was isolated from infected cap tissues using a dilution plate technique, sections of tissue (approximately 5×5×5 mm) with white blotch were rinsed three times in sterile deionized water, then, mashed in the sterile 2 ml eppendorf tubes, 1000µl sterile water was added and the suspension was diluted into eight concentrations (10-1~10-8). From each concentration, 120µl suspension was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28°C. Both 10-5 and 10-6 suspensions had single colonies, the dominant single colonies were picked and purified 2-3 times. The purified colonies were round, beige, and opaque, with a raised center and regular, smooth and moist margins. This bacterium is gram negative, short rod-shaped, single polar flagellum, motile, without pods or endospores, and produced fluorescent pigments on King's B medium. Amplified 16S rDNA (1396 bp; OM022022) of four randomly selected colonies using universal primers 27f/1492r, exhibited 100% identity with Pseudomonas (Ps.) mosselii. The partial sequences of the rpoB (1173bp; OM202622), rpoD (734bp; ON469579), gyrB (1383bp; OM202621) and recA (887bp; ON469580) genes of four selected colonies were amplified using primers LAPS5/LAFS27(Tayeb et al. 2005.), PsEG30F/PsEG790R (Mulet et al. 2009), gyrB-R/gyrB-F (Agaras et al. 2018) and recA-F (5'-3' ACGACAACAAGAAGCGCGCCTT)/recA-R (5'-3' CAATGGCCGGGTTCTCTTGCAGGTA) designed in this study, respectively, also exhibited 99%~100% similarities to Ps. mosselii. Phylogenetic analysis showed that isolates cluster with Ps. mosselii. The biochemical tests for isolates were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ps. mosselii (Positive for arginine dihydrolase, trisodium citrate, urea, lysine, arginine, ornithine and gelatin. Negative for glucosamine, lactose, galactose, rhamnose, maltose, sucrose, arabinose, mannose, xylose, esculoside, inositol, nitrate reduction and malonate) (Dabboussi et al.2002; Soto-Rodriguez et al. 2013). The isolates were identified as Ps. mosselii based on biochemical tests and phylogenetic analysis. This isolate was incubated in LB Broth at 28℃, 160 rpm for 24h and the bacterial cells were collected by centrifugation at 4000 rpm for 10min. The collected bacterial cells were resuspended in sterile deionized water to make a bacterial suspension. For pathogenicity tests, 30µl of bacterial suspension (approximately 1x10^9 CFU/mL) was added to the surface of the cap (3-4cm) of young P. pulmonarius. Sterile deionized water was added as a negative control. All treatments were incubated at 22°C and 80-85% humidity. The experiment was repeated three times with three bags each time. 12 h later, white blotches were visible on all parts of the inoculated mushroom. This disease symptoms were similar to those observed in the original samples. However, no disease phenomena were observed in the negative control group. After the pathogenicity test, we obtained the same pathogen as the initially isolates from infected tissues based on morphological characteristics, 16S rDNA sequences, rpoB, rpoD, gyrB and recA sequences, and biochemical test results. Ps. mosselii was first isolated clinically and described by Dabboussi et al. (2002). It has shown to be pathogenic to Oreochromis niloticus and humans (Soto-Rodriguez et al. 2013; Peña et al. 2019; Leneveu-Jenvrin et al. 2013; Huang et al. 2018.). However, to the best of our knowledge, this is the first report of Ps. mosselii causing white blotch disease in P. pulmonarius worldwide, which negatively affects the commercial value of P. pulmonarius and requires attention of mushroom industry.
PubMed: 35822894
DOI: 10.1094/PDIS-01-22-0201-PDN