-
Anesthesia and Analgesia Oct 2010Unfractionated heparin's primary mechanism of action is to enhance the enzymatic activity of antithrombin (AT). We hypothesized that there would be a direct association... (Comparative Study)
Comparative Study Review
BACKGROUND
Unfractionated heparin's primary mechanism of action is to enhance the enzymatic activity of antithrombin (AT). We hypothesized that there would be a direct association between preoperative AT activity and both heparin dose response (HDR) and heparin sensitivity index (HSI) in patients undergoing coronary artery bypass graft surgery.
METHODS
Demographic and perioperative data were collected from 304 patients undergoing primary coronary artery bypass graft surgery. AT activity was measured after induction of general anesthesia using a colorimetric method (Siemens Healthcare Diagnostics, Tarrytown, NY). Activated coagulation time (ACT), HDR, and HSI were measured using the Hepcon HMS Plus system (Medtronic, Minneapolis, MN). Heparin dose was calculated for a target ACT using measured HDR by the same system. Multivariate linear regression was performed to identify independent predictors of HDR. Subgroup analysis of patients with low AT activity (<80% normal; <0.813 U/mL) who may be at risk for heparin resistance was also performed.
RESULTS
Mean baseline ACT was 135 ± 18 seconds. Mean calculated HDR was 98 ± 21 s/U/mL. Mean baseline AT activity was 0.93 ± 0.13 U/mL. Baseline AT activity was not significantly associated with baseline or postheparin ACT, HDR, or HSI. Addition of AT activity to multivariable linear regression models of both HDR and HSI did not significantly improve model performance. Subgroup analysis of 49 patients with baseline AT <80% of normal levels did not reveal a relationship between low AT activity and HDR or HSI. Preoperative AT activity, HDR, and HSI were not associated with cardiac troponin I levels on the first postoperative day, intensive care unit duration, or hospital length of stay.
CONCLUSION
Although enhancing AT activity is the primary mechanism by which heparin facilitates cardiopulmonary bypass anticoagulation, low preoperative AT activity is not associated with impaired response to heparin or to clinical outcomes when using target ACTs of 300 to 350 seconds.
Topics: Aged; Antithrombin III; Coronary Artery Bypass; Dose-Response Relationship, Drug; Female; Heparin; Humans; Male; Middle Aged; Preoperative Care; Whole Blood Coagulation Time
PubMed: 20142342
DOI: 10.1213/ANE.0b013e3181ce1ffa -
Medicine Nov 2022Inherited antithrombin deficiency (ATD) is a major cause of thrombotic deficiency. Genetic testing is of great value in the diagnosis of hereditary thrombophilia....
RATIONALE
Inherited antithrombin deficiency (ATD) is a major cause of thrombotic deficiency. Genetic testing is of great value in the diagnosis of hereditary thrombophilia. Herein, we report a case of inherited ATD admitted to our hospital. We include the results of genealogy and discuss the significance of genetic testing in high-risk groups of hereditary thrombophilia.
PATIENT CONCERNS
A 16-year-old male patient presented with chest tightness, shortness of breath, wheezing, and intermittent fever (up to 39 °C) after strenuous exercise for 2 weeks. He also had a cough with white sputum with a small amount of bright red blood in the sputum and occasional back pain.
DIAGNOSES
The blood tests showed that the patient's antithrombin III concentration and activity were both significantly reduced to 41% and 43.2%, respectively. Enhanced chest computed tomography scans showed pulmonary infarction in the lower lobe of the right lung with multiple embolisms in the bilateral pulmonary arteries and branches. Lower vein angiography revealed a contrast-filling defect of the inferior vena cava and left common iliac vein. Thrombosis was considered as a differential diagnosis. His father and his uncle also had a history of thrombosis. The patient was diagnosed with inherited ATD. Further, peripheral venous blood samples of the family members were collected for whole-exome gene sequencing, and Sanger sequencing was used to verify the gene mutation site in the family. The patient and his father had a SERPINC1 gene duplication mutation: c.1315_1345dupCCTTTCCTGGTTTTTAAGAGAAGTTCCTC (NM000488.4).
INTERVENTIONS
An inferior vena cava filter was inserted to avoid thrombus shedding from the lower limbs. Urokinase was injected intermittently through the femoral vein cannula for thrombolysis. Heparin combined with warfarin anticoagulant therapy was sequentially administered. After reaching the international normalized ratio, heparin was discontinued, and oral warfarin anticoagulant therapy was continued. After discharge, the patient was switched to rivaroxaban as oral anticoagulation therapy.
OUTCOMES
The patient's clinical symptoms disappeared. reexamination showed that the thrombotic load was less than before, and the inferior vena cava filter was then removed.
LESSONS
By this report we highlight that gene detection and phenotypic analysis are important means to study inherited ATD.
Topics: Male; Humans; Adolescent; Warfarin; Antithrombin III Deficiency; Thrombophilia; Vena Cava, Inferior; Anticoagulants; Heparin; Mutation; Thrombosis; Antithrombins; Antithrombin III
PubMed: 36343066
DOI: 10.1097/MD.0000000000031240 -
Blood Dec 2003Cambridge II (A384S) is a highly prevalent antithrombin variant in the British population (1.14 per 1000) and predisposes carriers to a mild but significant increased...
Cambridge II (A384S) is a highly prevalent antithrombin variant in the British population (1.14 per 1000) and predisposes carriers to a mild but significant increased risk of thrombosis. To determine if the association of Cambridge II with thrombophilia is due to a perturbation of the antithrombin inhibitory mechanism, we expressed and characterized the variant. Antithrombin Cambridge II was found to be normal in its affinity for heparin, its ability to form sodium dodecyl sulfate-stable complexes with factor Xa and thrombin, and its uncatalyzed stoichiometries and rates of inhibition. However, in the presence of full-length heparin there was a 3- and 7-fold increase in stoichiometry of inhibition of factor Xa and thrombin. The stoichiometries were not affected by pentasaccharides, indicating that the inhibitory mechanism of antithrombin Cambridge II is perturbed only in the presence of a bridging glycosaminoglycan. Thus, the vascular localization of antithrombin Cambridge II would render the carrier slightly thrombophilic. The high occurrence of this mutation and its possible propagation from a few founders suggests an evolutionary advantage, perhaps in decreasing postpartum bleeding.
Topics: Allosteric Regulation; Antithrombin III; Factor Xa Inhibitors; Genetic Variation; Heparin; Humans; Kinetics; Point Mutation; Protein Binding; Recombinant Proteins; Thrombophilia
PubMed: 12907439
DOI: 10.1182/blood-2003-05-1560 -
Blood May 2013Mice deficient in the anticoagulants antithrombin (Serpinc1) or protein C (Proc) display premature death due to thrombosis-related coagulopathy, thereby precluding their...
Mice deficient in the anticoagulants antithrombin (Serpinc1) or protein C (Proc) display premature death due to thrombosis-related coagulopathy, thereby precluding their use in gene function studies and thrombosis models. We used RNA interference to silence Serpinc1 and/or Proc in normal adult mice. The severe coagulopathy that followed combined "knockdown" of these genes is reported. Two days after siRNA injection, thrombi (occlusive) were observed in vessels (large and medium-sized) in multiple tissues, and hemorrhages were prominent in the ocular, mandibular, and maxillary areas. Tissue fibrin deposition and reduction of plasma fibrinogen accompanied this phenotype. The coagulopathy was prevented by dabigatran etexilate treatment. Silencing of Serpinc1 alone yielded a comparable but milder phenotype with later onset. The phenotype was absent when Proc was targeted alone. We conclude that RNA interference of Serpinc1 and/or Proc allows for evaluation of the function of these genes in vivo and provides a novel, controlled mouse model for spontaneous venous thrombosis.
Topics: Acute Disease; Animals; Antithrombin III; Blood Coagulation Disorders; Disease Models, Animal; Female; Gene Silencing; Liver; Mice; Mice, Inbred C57BL; Phenotype; Protein C; RNA, Small Interfering; Severity of Illness Index; Venous Thrombosis
PubMed: 23550037
DOI: 10.1182/blood-2012-11-465674 -
The Biochemical Journal Aug 1986In order to identify the regions of antithrombin that interact with heparin and thrombin, it was degraded with CNBr and the activities of the isolated products were...
In order to identify the regions of antithrombin that interact with heparin and thrombin, it was degraded with CNBr and the activities of the isolated products were investigated. These fragments did not exhibit direct thrombin-neutralizing activity; however, one unique fragment was found to bind to heparin-Sepharose and also to interfere with the inhibition of thrombin by intact antithrombin. This fragment was identified as the one consisting of three disulphide-linked polypeptide chains containing residues 1-17, 104-251 and 424-432. At a concentration of 46 nM, this product decreased the heparin-enhanced thrombin-inhibitory activity of antithrombin by half, and completely abolished this inhibition when above 300 nM. In the absence of heparin, the action of antithrombin was not completely nullified by the fragment, even when present at relatively high concentrations. At a given fragment concentration, the extent of inhibition was independent of antithrombin concentration over the range tested. It was found that the fragment decreased the second-order rate constant for the antithrombin-thrombin reaction. Reduction and alkylation of the fragment showed that the above properties reside primarily in the peptide with residues 104-251. It is concluded that this peptide possesses portions of the antithrombin molecule that bind to heparin as well as to a site on thrombin.
Topics: Alkylation; Amino Acids; Antithrombin III; Antithrombins; Heparin; Oxidation-Reduction; Peptide Fragments; Protein Binding; Thrombin
PubMed: 3800906
DOI: 10.1042/bj2370639 -
Nucleic Acids Research Dec 1982A partial cDNA clone for human antithrombin III (ATIII) was obtained by screening a cDNA library prepared from size fractionated liver RNA with a pool of eight 16-base...
A partial cDNA clone for human antithrombin III (ATIII) was obtained by screening a cDNA library prepared from size fractionated liver RNA with a pool of eight 16-base long synthetic DNA fragments whose sequence was determined from protein sequence data. A fragment of the partial cDNA clone was used to enrich RNA for ATIII messages, and cDNA clones encoding the entire ATIII structural gene were identified. The complete nucleotide and predicted amino acid sequences of human ATIII and its 32 residue signal peptide are reported, and provide further opportunity to compare the ATIII primary structure with corresponding regions from homologous proteins, alpha 1-antitrypsin and ovalbumin. Plasmids in which the structural genes for mature and pre-ATIII were linked to the E. coli trp promoter-operator support the synthesis of human antithrombin III and pre-antithrombin III in bacteria.
Topics: Amino Acid Sequence; Antithrombin III; Base Sequence; Cloning, Molecular; DNA; DNA Restriction Enzymes; Escherichia coli; Genes; Humans; Liver; Nucleic Acid Hybridization; Plasmids; RNA, Messenger; Transcription, Genetic
PubMed: 6298709
DOI: 10.1093/nar/10.24.8113 -
The Journal of Biological Chemistry Mar 1998To determine the role of individual saccharide residues of a specific heparin pentasaccharide, denoted DEFGH, in the allosteric activation of the serpin, antithrombin,...
Mechanism of heparin activation of antithrombin. Role of individual residues of the pentasaccharide activating sequence in the recognition of native and activated states of antithrombin.
To determine the role of individual saccharide residues of a specific heparin pentasaccharide, denoted DEFGH, in the allosteric activation of the serpin, antithrombin, we studied the effect of deleting pentasaccharide residues on this activation. Binding, spectroscopic, and kinetic analyses demonstrated that deletion of reducing-end residues G and H or nonreducing-end residue D produced variable losses in pentasaccharide binding energy of approximately 15-75% but did not affect the oligosaccharide's ability to conformationally activate the serpin or to enhance the rate at which the serpin inhibited factor Xa. Rapid kinetic studies revealed that elimination of the reducing-end disaccharide marginally affected binding to the native low-heparin-affinity conformational state of antithrombin but greatly affected the conversion of the serpin to the activated high-heparin- affinity state, although the activated conformation was still favored. In contrast, removal of the nonreducing- end residue D drastically affected the initial low-heparin-affinity interaction so as to favor an alternative activation pathway wherein the oligosaccharide shifted a preexisiting equilibrium between native and activated serpin conformations in favor of the activated state. These results demonstrate that the nonreducing-end residues of the pentasaccharide function both to recognize the native low-heparin-affinity conformation of antithrombin and to induce and stabilize the activated high-heparin-affinity conformation. Residues at the reducing-end, however, poorly recognize the native conformation and instead function primarily to bind and stabilize the activated antithrombin conformation. Together, these findings establish an important role of the heparin pentasaccharide sequence in preferential binding and stabilization of the activated conformational state of the serpin.
Topics: Antithrombin III; Binding, Competitive; Enzyme Activation; Factor Xa Inhibitors; Heparin; Humans; Kinetics; Models, Chemical; Oligosaccharides; Protein Conformation; Spectrometry, Fluorescence; Structure-Activity Relationship
PubMed: 9516447
DOI: 10.1074/jbc.273.13.7478 -
The Journal of Thoracic and... Feb 2002The purpose of this report is to describe the clinical use of antithrombin III concentrate in 53 patients who were found, in the operating room before cardiopulmonary...
OBJECTIVE
The purpose of this report is to describe the clinical use of antithrombin III concentrate in 53 patients who were found, in the operating room before cardiopulmonary bypass, to be heparin resistant.
METHOD
Resistance to heparin was determined to be present when greater than 600 U/kg body weight of heparin failed to prolong the kaolin-activated clotting time to more than 600 seconds in 53 aprotinin-treated patients. Blood samples were obtained for subsequent antithrombin III activity determination. Patients were then administered 500 U of antithrombin III concentrate, and the activated clotting time was remeasured. If the activated clotting time remained less than 600 seconds, a second 500-U dose was given.
RESULTS
Of the 53 patients, 45 (85%) had subnormal measured antithrombin III activity, and the mean plasma antithrombin III activity level for the entire group was 67% (normal 80%-120%). Administration of antithrombin III concentrate (500 U in 45 patients and 1000 U in 8 patients) resulted in prolongation of the mean activated clotting time from 492 to 789 seconds without additional heparin. The mean heparin dose response increased from 36.5 to 69.3 s x U(-1) x mL(-1) with antithrombin III treatment. Only one patient did not achieve the target activated clotting time, despite administration of greater than 600 U/kg heparin and 1000 U of antithrombin III concentrate, and was treated with fresh-frozen plasma.
CONCLUSIONS
On the basis of the criterion used in this report, most of the patients defined as being heparin resistant had subnormal plasma antithrombin III activity. Treatment with antithrombin III concentrate resulted in potentiation of the heparin effect to meet predetermined activated clotting time thresholds and allow for cardiopulmonary bypass.
Topics: Aged; Anticoagulants; Antithrombin III; Cardiac Surgical Procedures; Coronary Artery Bypass; Dose-Response Relationship, Drug; Drug Resistance; Female; Heparin; Humans; Male; Whole Blood Coagulation Time
PubMed: 11828278
DOI: 10.1067/mtc.2002.119060 -
Kidney International Oct 2015Antithrombin III, encoded by SerpinC1, is a major anti-coagulation molecule in vivo and has anti-inflammatory effects. We found that patients with low antithrombin III...
Antithrombin III, encoded by SerpinC1, is a major anti-coagulation molecule in vivo and has anti-inflammatory effects. We found that patients with low antithrombin III activities presented a higher risk of developing acute kidney injury after cardiac surgery. To study this further, we generated SerpinC1 heterozygous knockout rats and followed the development of acute kidney injury in a model of modest renal ischemia/reperfusion injury. Renal injury, assessed by serum creatinine and renal tubular injury scores after 24 h of reperfusion, was significantly exacerbated in SerpinC1(+/-) rats compared to wild-type littermates. Concomitantly, renal oxidative stress, tubular apoptosis, and macrophage infiltration following this injury were significantly aggravated in SerpinC1(+/-) rats. However, significant thrombosis was not found in the kidneys of any group of rats. Antithrombin III is reported to stimulate the production of prostaglandin I2, a known regulator of renal cortical blood flow, in addition to having anti-inflammatory effects and to protect against renal failure. Prostaglandin F1α, an assayable metabolite of prostaglandin I2, was increased in the kidneys of the wild-type rats at 3 h after reperfusion. The increase of prostaglandin F1α was significantly blunted in SerpinC1(+/-) rats, which preceded increased tubular injury and oxidative stress. Thus, our study found a novel role of SerpinC1 insufficiency in increasing the severity of renal ischemia/reperfusion injury.
Topics: Acute Kidney Injury; Aged; Animals; Antithrombin III; Antithrombin III Deficiency; Apoptosis; Biomarkers; Cardiac Surgical Procedures; Creatinine; Disease Models, Animal; Female; Gene Knockdown Techniques; Genetic Predisposition to Disease; Heterozygote; Humans; Kidney; Macrophages; Male; Middle Aged; Oxidative Stress; Phenotype; Prostaglandins F; Rats, Transgenic; Reperfusion Injury; Risk Factors; Severity of Illness Index; Signal Transduction; Time Factors
PubMed: 26108065
DOI: 10.1038/ki.2015.176 -
Blood Jul 2012The balance between actions of procoagulant and anticoagulant factors protects organisms from bleeding and thrombosis. Thus, antithrombin deficiency increases the risk...
The balance between actions of procoagulant and anticoagulant factors protects organisms from bleeding and thrombosis. Thus, antithrombin deficiency increases the risk of thrombosis, and complete quantitative deficiency results in intrauterine lethality. However, patients homozygous for L99F or R47C antithrombin mutations are viable. These mutations do not modify the folding or secretion of the protein, but abolish the glycosaminoglycan-induced activation of antithrombin by affecting the heparin-binding domain. We speculated that the natural β-glycoform of antithrombin might compensate for the effect of heparin-binding mutations. We purified α- and β-antithrombin glycoforms from plasma of 2 homozygous L99F patients. Heparin affinity chromatography and intrinsic fluorescence kinetic analyses demonstrated that the reduced heparin affinity of the α-L99F glycoform (K(D), 107.9 ± 3nM) was restored in the β-L99F glycoform (K(D), 53.9 ± 5nM) to values close to the activity of α-wild type (K(D), 43.9 ± 0.4nM). Accordingly, the β-L99F glycoform was fully activated by heparin. Similar results were observed for recombinant R47C and P41L, other heparin-binding antithrombin mutants. In conclusion, we identified a new type of mosaicism associated with mutations causing heparin-binding defects in antithrombin. The presence of a fully functional β-glycoform together with the activity retained by these variants helps to explain the viability of homozygous and the milder thrombotic risk of heterozygous patients with these specific antithrombin mutations.
Topics: Antithrombin III; Antithrombin III Deficiency; Binding Sites; Chromatography, Affinity; DNA; Heparin; Heterozygote; Homozygote; Humans; Kinetics; Male; Mosaicism; Mutation; Pedigree; Polymerase Chain Reaction; Protein Binding; Protein Conformation; Protein Processing, Post-Translational; Spectrometry, Mass, Matrix-Assisted Laser Desorption-Ionization; Thrombosis
PubMed: 22498748
DOI: 10.1182/blood-2012-01-406207