-
Cold Spring Harbor Perspectives in... Nov 2013The expression levels of the MYC oncoprotein have long been recognized to be associated with the outputs of major cellular processes including proliferation, cell... (Review)
Review
The expression levels of the MYC oncoprotein have long been recognized to be associated with the outputs of major cellular processes including proliferation, cell growth, apoptosis, differentiation, and metabolism. Therefore, to understand how MYC operates, it is important to define quantitatively the relationship between MYC input and expression output for its targets as well as the higher-order relationships between the expression levels of subnetwork components and the flow of information and materials through those networks. Two different views of MYC are considered, first as a molecular microeconomic manager orchestrating specific positive and negative responses at individual promoters in collaboration with other transcription and chromatin components, and second, as a macroeconomic czar imposing an overarching rule onto all active genes. In either case, c-myc promoter output requires multiple inputs and exploits diverse mechanisms to tune expression to the appropriate levels relative to the thresholds of expression that separate health and disease.
Topics: DNA; Gene Amplification; Genes, myc; Humans; Promoter Regions, Genetic; Proto-Oncogene Proteins c-myc
PubMed: 24186489
DOI: 10.1101/cshperspect.a014233 -
Biochimica Et Biophysica Acta Nov 2014The product of proto-oncogene Ron is a human receptor for the macrophage-stimulating protein (MSP). Upon activation, Ron is able to induce cell dissociation, migration...
The product of proto-oncogene Ron is a human receptor for the macrophage-stimulating protein (MSP). Upon activation, Ron is able to induce cell dissociation, migration and matrix invasion. Exon 11 skipping of Ron pre-mRNA produces Ron△165 protein that is constitutively active even in the absence of its ligand. Here we show that knockdown of SRSF2 promotes the decrease of exon 11 inclusion, whereas overexpression of SRSF2 promotes exon 11 inclusion. We demonstrate that SRSF2 promotes exon 11 inclusion through splicing and transcription procedure. We also present evidence that reduced expression of SRSF2 induces a decrease in the splicing of both introns 10 and 11; by contrast, overexpression of SRSF2 induces an increase in the splicing of introns 10 and 11. Through mutation analysis, we show that SRSF2 functionally targets and physically interacts with CGAG sequence on exon 11. In addition, we reveal that the weak strength of splice sites of exon 11 is not required for the function of SRSF2 on the splicing of Ron exon 11. Our results indicate that SRSF2 promotes exon 11 inclusion of Ron proto-oncogene through targeting exon 11. Our study provides a novel mechanism by which Ron is expressed.
Topics: Cells, Cultured; Exons; HeLa Cells; Humans; Isoenzymes; Nuclear Proteins; Proto-Oncogene Mas; Proto-Oncogenes; RNA Splicing; Receptor Protein-Tyrosine Kinases; Ribonucleoproteins; Serine-Arginine Splicing Factors; Transcription, Genetic
PubMed: 25220236
DOI: 10.1016/j.bbagrm.2014.09.003 -
PloS One 2008Establishment and maintenance of a functional central nervous system (CNS) requires a highly orchestrated process of neural progenitor cell proliferation, cell cycle...
BACKGROUND
Establishment and maintenance of a functional central nervous system (CNS) requires a highly orchestrated process of neural progenitor cell proliferation, cell cycle exit, and differentiation. An evolutionary conserved program consisting of Notch signalling mediated by basic Helix-Loop-Helix (bHLH) transcription factor activity is necessary for both the maintenance of neural progenitor cell character and the progression of neurogenesis; however, additional players in mammalian CNS neural specification remain largely unknown. In Drosophila we recently characterized Hamlet, a transcription factor that mediates Notch signalling and neural cell fate.
METHODOLOGY/PRINCIPAL FINDINGS
Hamlet is a member of the Prdm (PRDI-BF1 and RIZ homology domain containing) proto-oncogene transcription factor family, and in this study we report that multiple genes in the Prdm family (Prdm6, 8, 12, 13 and 16) are expressed in the developing mouse CNS in a spatially and temporally restricted manner. In developing spinal cord Prdm8, 12 and 13 are expressed in precise neuronal progenitor zones suggesting that they may specify discrete neuronal subtypes. In developing telencephalon Prdm12 and 16 are expressed in the ventricular zone in a lateral to medial graded manner, and Prdm8 is expressed in a complementary domain in postmitotic neurons. In postnatal brain Prdm8 additionally shows restricted expression in cortical layers 2/3 and 4, the hippocampus, and the amygdala. To further elucidate roles of Prdm8 and 16 in the developing telencephalon we analyzed the relationship between these factors and the bHLH Hes (Hairy and enhancer of split homolog) effectors of Notch signalling. In Hes null telencephalon neural differentiation is enhanced, Prdm8 expression is upregulated, and Prdm16 expression is downregulated; conversely in utero electroporation of Hes1 into the developing telencephalon upregulates Prdm16 expression.
CONCLUSIONS/SIGNIFICANCE
Our data demonstrate that Prdm genes are regulated by the Notch-Hes pathway and represent strong candidates to control neural class specification and the sequential progression of mammalian CNS neurogenesis.
Topics: Animals; Basic Helix-Loop-Helix Transcription Factors; Central Nervous System; Embryonic Development; Gene Expression; Gene Expression Regulation; In Situ Hybridization; Mice; Multigene Family; Neurogenesis; Neurons; Proto-Oncogenes; Reverse Transcriptase Polymerase Chain Reaction; Transcription Factors
PubMed: 19050759
DOI: 10.1371/journal.pone.0003859 -
Archives of Pathology & Laboratory... Jul 2018
Topics: Anaplastic Lymphoma Kinase; Humans; Immunohistochemistry; Lung Neoplasms; Pathologists; Pathology, Molecular; Protein-Tyrosine Kinases; Proto-Oncogene Mas; Proto-Oncogenes; Reactive Oxygen Species; Tyrosine; United States
PubMed: 29607662
DOI: 10.5858/arpa.2018-0066-ED -
Scientific Reports Mar 2019G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1:...
G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy. By application of various NMR spectra, we proved the formation of a four-layer G-quadruplex composing of two G-tetrads and two G/A-mixed planes with a four-residues loop (A3-G4-A5-A6). Further evidence from a luciferase reporter assay, Q-RT-PCR and Western blotting indicates that S1 G-quadruplex formation can repress her2 promoter activity, and a selected G-quadruplex ligand cβ can enhance the repression by down regulating her2 transcription and expression. These findings provide a G-quadruplex target and perspective implications in her2 transcriptional regulation.
Topics: Cell Line, Tumor; Down-Regulation; G-Quadruplexes; Gene Expression Regulation; Humans; MCF-7 Cells; Magnetic Resonance Spectroscopy; Nucleic Acid Conformation; Promoter Regions, Genetic; Proto-Oncogene Mas; Proto-Oncogenes; Receptor, ErbB-2; Transcription, Genetic
PubMed: 30850693
DOI: 10.1038/s41598-019-39941-5 -
FEBS Letters Jun 1993Apoptosis is a physiological process for active cell removal. One of its hallmarks is an increased cytosolic Ca2+ content. Several genes involved in apoptosis control... (Review)
Review
Apoptosis is a physiological process for active cell removal. One of its hallmarks is an increased cytosolic Ca2+ content. Several genes involved in apoptosis control have been identified, but their mode of action is not understood in detail. Apoptosis may relate to oncogenesis, in that some malignant tumors may grow because genes engaged in apoptosis control are altered. L929 cells overexpressing the proto-oncogene bcl-2 have an increased mitochondrial membrane potential (delta psi), as have many carcinoma cells. bcl-2 protects L929 cells against apoptosis caused by pro-oxidant-induced mitochondrial Ca2+ 'cycling' and increased cytosolic Ca2+ levels. Nerve growth factor, which induces catalase, and inhibitors of mitochondrial Ca2+ release also prevent apoptosis. It is suggested that a pro-oxidant-induced Ca2+ release from mitochondria, followed by Ca2+ cycling and ATP depletion, is a common basic event during apoptosis. Accordingly, maintenance of delta psi stabilizes mitochondria, thereby prevents apoptosis, and may confer increased growth potential to cells.
Topics: Animals; Apoptosis; Calcium; Cell Transformation, Neoplastic; Mitochondria; Oxidants; Proto-Oncogene Proteins; Proto-Oncogene Proteins c-bcl-2; Proto-Oncogenes
PubMed: 8513880
DOI: 10.1016/0014-5793(93)81423-w -
Journal of Clinical Pathology Sep 1987In recent years cellular homologues of many viral oncogenes have been identified. As these genes are partially homologous to viral oncogenes and are activated in some... (Review)
Review
In recent years cellular homologues of many viral oncogenes have been identified. As these genes are partially homologous to viral oncogenes and are activated in some tumour cell lines they are termed "proto-oncogenes". In tumour cell lines proto-oncogenes are activated by either quantitative or qualitative changes in gene structure: activation of these genes was originally thought to be a necessary primary event in carcinogenesis, but activated cellular oncogenes, unlike viral oncogenes, do not transform normal cells in culture. In experimental models cooperation between two oncogenes can induce transformation of early passage cells, and this has become the basis of an hypothesis for multistep carcinogenesis. Proto-oncogene products also show sequence homology to various components in the mitogenic pathway (growth factors, growth factor receptors, signal transducing proteins and nuclear proteins), and it has been postulated that they may cause deregulation of the various components of this pathway. In human tumours single or multiple oncogene activation occurs. The pattern of oncogene activation in common solid malignancies is not consistent within any one class of tumour, nor is it uniform between classes, with three exceptions. In neuroblastoma, breast cancer, and perhaps in lung cancer there is relatively consistent activation of N-myc, neu, and c-myc/N-myc, respectively. Amplification of these genes generally correlates with poor prognosis. The introduction of methods for the direct study of oncogene transcription and their products will undoubtedly broaden our vision of cancer biology in man and, hopefully, add diagnostic and prognostic precision to tumour typing.
Topics: Animals; Cell Transformation, Neoplastic; Cell Transformation, Viral; Female; Humans; Mice; Models, Genetic; Neoplasms; Oncogenes; Proto-Oncogene Mas; Proto-Oncogenes; Rats; Retroviridae
PubMed: 3312299
DOI: 10.1136/jcp.40.9.1055 -
Molecular Cancer Jan 2024In the early 1990's a group of unrelated genes were identified from the sites of recurring translocations in B-cell lymphomas. Despite sharing the nomenclature 'Bcl',... (Review)
Review
In the early 1990's a group of unrelated genes were identified from the sites of recurring translocations in B-cell lymphomas. Despite sharing the nomenclature 'Bcl', and an association with blood-borne cancer, these genes have unrelated functions. Of these genes, BCL2 is best known as a key cancer target involved in the regulation of caspases and other cell viability mechanisms. BCL3 on the other hand was originally identified as a non-canonical regulator of NF-kB transcription factor pathways - a signaling mechanism associated with important cell outcomes including many of the hallmarks of cancer. Most of the early investigations into BCL3 function have since focused on its role in NF-kB mediated cell proliferation, inflammation/immunity and cancer. However, recent evidence is coming to light that this protein directly interacts with and modulates a number of other signaling pathways including DNA damage repair, WNT/β-catenin, AKT, TGFβ/SMAD3 and STAT3 - all of which have key roles in cancer development, metastatic progression and treatment of solid tumours. Here we review the direct evidence demonstrating BCL3's central role in a transcriptional network of signaling pathways that modulate cancer biology and treatment response in a range of solid tumour types and propose common mechanisms of action of BCL3 which may be exploited in the future to target its oncogenic effects for patient benefit.
Topics: Humans; NF-kappa B; Neoplasm Recurrence, Local; Proto-Oncogenes; Hematologic Neoplasms; Cell Proliferation
PubMed: 38195591
DOI: 10.1186/s12943-023-01922-8 -
International Journal of Molecular... 2012An important assumption of our current understanding of the mechanisms of carcinogenesis has been the belief that clarification of the cancer process would inevitably... (Review)
Review
An important assumption of our current understanding of the mechanisms of carcinogenesis has been the belief that clarification of the cancer process would inevitably reveal some of the crucial mechanisms of normal human gene regulation. Since the momentous work of Bishop and Varmus, both the molecular and the biochemical processes underlying the events in the development of cancer have become increasingly clear. The identification of cellular signaling pathways and the role of protein kinases in the events leading to gene activation have been critical to our understanding not only of normal cellular gene control mechanisms, but also have clarified some of the important molecular and biochemical events occurring within a cancer cell. We now know that oncogenes are dysfunctional proto-oncogenes and that dysfunctional tumor suppressor genes contribute to the cancer process. Furthermore, Weinstein and others have hypothesized the phenomenon of oncogene addiction as a distinct characteristic of the malignant cell. It can be assumed that cancer cells, indeed, become dependent on such vital oncogenes. The products of these vital oncogenes, such as c-myc, may well be the Achilles heel by which targeted molecular therapy may lead to truly personalized cancer therapy. The remaining problem is the need to introduce relevant molecular diagnostic tests such as genome microarray analysis and proteomic methods, especially protein kinase identification arrays, for each individual patient. Genome wide association studies on cancers with gene analysis of single nucleotide and other mutations in functional proto-oncogenes will, hopefully, identify dysfunctional proto-oncogenes and allow the development of more specific targeted drugs directed against the protein products of these vital oncogenes. In 1984 Willis proposed a molecular and biochemical model for eukaryotic gene regulation suggesting how proto-oncogenes might function within the normal cell. That model predicted the existence of vital oncogenes and can now be used to hypothesize the biochemical and molecular mechanisms that drive the processes leading to disruption of the gene regulatory machinery, resulting in the transformation of normal cells into cancer.
Topics: Cyclin-Dependent Kinases; Epigenesis, Genetic; Genome, Human; Humans; Models, Theoretical; Neoplasms; Phosphoproteins; Proto-Oncogene Proteins c-myc; Proto-Oncogenes; Retinoblastoma Protein
PubMed: 22312254
DOI: 10.3390/ijms13010316 -
FEBS Letters Nov 1992We have shown previously that angiotensin-II (A-II) controls proto-oncogene (c-fos, jun-B and c-jun) mRNA accumulation in bovine adrenal fasciculata cells (BAC). Since...
We have shown previously that angiotensin-II (A-II) controls proto-oncogene (c-fos, jun-B and c-jun) mRNA accumulation in bovine adrenal fasciculata cells (BAC). Since BAC contain both subtypes (AT-1 and AT-2) of the A-II receptor, we have investigated which subtype was involved in the effect of A-II on proto-oncogene mRNA by using a selective antagonist for AT-1 (DUP 753) and for AT-2 (CGP 42112A). DUP 753, but not CGP 42112A, inhibited the stimulatory effect of A-II on proto-oncogene mRNA, with ID50s of 4 x 10(-7) M, 7 x 10(-7) M and 2 x 10(-6) M for c-fos, jun-B and c-jun, respectively. Neither of the two antagonists by themselves had a direct effect on proto-oncogene mRNA. As the A-II AT-1 receptors are coupled to the phospholipase C system in BAC, we have investigated whether the A-II effects on the proto-oncogenes were mediated by protein kinase C (PKC) or by Ca2+ calmodulin. First, activation of PKC by the phorbol ester, PMA, increased the level of three proto-oncogene mRNAs, whereas calcium ionophore had no effect. Second, staurosporine, a specific inhibitor of PKC, reduced the stimulatory action of A-II on proto-oncogene mRNA by 80-90%, whereas trifluoroperazine, an inhibitor of calmodulin, had no significant effect. These results demonstrate that the effects of A-II on proto-oncogene mRNA are mediated by AT1 receptor subtypes, mainly through activation of the PKC pathway.
Topics: Angiotensin II; Animals; Blotting, Northern; Calmodulin; Cattle; Cells, Cultured; Enzyme Activation; Gene Expression Regulation; Genes, fos; Genes, jun; Protein Kinase C; RNA, Messenger; Receptors, Angiotensin; Zona Fasciculata
PubMed: 1426267
DOI: 10.1016/0014-5793(92)81180-t