-
Blood Coagulation & Fibrinolysis : An... Jun 2024Immune thrombocytopenia (ITP) is an autoimmune disease that arises because of self-destruction of circulating platelets. The mechanism remains complicated and lacks a...
Immune thrombocytopenia (ITP) is an autoimmune disease that arises because of self-destruction of circulating platelets. The mechanism remains complicated and lacks a standard clinical treatment. Current first-line and second-line medications for ITP have shown limited effectiveness, necessitating the exploration of new therapeutic options. Sirolimus is a mammalian target of rapamycin (mTOR) inhibitor that has been demonstrated to inhibit lymphocyte activity, indicating potential for SRL in the treatment of ITP. This study aimed to evaluate the clinical efficacy of sirolimus as a second-line drug in patients with ITP. The starting dose of sirolimus for adults ranged from 2 to 4 mg/day, with a maintenance dose of 1 to 2 mg/day. For children, the starting dose was 1-2 mg/day, with a maintenance dose of 0.5-1 mg/day. The dosage could be adjusted if needed to maintain a specific blood concentration of sirolimus, typically between 5 and 15 ng/ml, throughout the treatment period. After 3 months, the overall response rate was 60% (12/20), with 30% of patients (6/20) achieving a complete response (CR) and 30% (6/20) achieving a partial response (PR). The CR rate at 6 months remained consistent with the 3-month assessment. No major adverse events were reported, indicating that sirolimus was well tolerated and safe. Analysis of peripheral blood Treg cell percentages in both the control and ITP showed no significant difference before treatment. The percentage of Treg cells increased after treatment with sirolimus, suggesting that sirolimus increases Treg cells. These findings suggest that sirolimus serves as an effective second-line treatment option for ITP, demonstrating favorable clinical efficacy.
Topics: Humans; Sirolimus; Female; Purpura, Thrombocytopenic, Idiopathic; Male; Adult; Middle Aged; Adolescent; Young Adult; Child; Immunosuppressive Agents; Aged; Treatment Outcome; Child, Preschool
PubMed: 38625834
DOI: 10.1097/MBC.0000000000001303 -
Journal of Veterinary Internal Medicine 2024The immature platelet fraction (IPF), a parameter obtained by the Sysmex XN-1000V analyzer, is used in humans to differentiate between central (CEN) and peripheral (PER)...
BACKGROUND
The immature platelet fraction (IPF), a parameter obtained by the Sysmex XN-1000V analyzer, is used in humans to differentiate between central (CEN) and peripheral (PER) thrombocytopenia (TP) but has not been evaluated in small animals.
OBJECTIVES
Compare IPF between healthy, clinical non-TP and TP dogs and cats, study IPF in different causes of TP in dogs and cats and, establish IPF reference intervals (RIs), and study the effect of age and sex on IPF in healthy dogs and cats.
ANIMALS
A total of 3281 dogs and 726 cats.
METHODS
Retrospective review of medical records. Animals were classified as nonthrombocytopenic (healthy group and group of clinical patients without TP [NTP]) or TP. These latter animals were subclassified as pseudothrombocytopenia (PSE), CEN and PER, based on evaluation of platelet clumps, estimated platelet count in blood smears and final diagnosis. Blood samples were evaluated using a Sysmex XN-1000V with a specific platelet channel (PLT-F).
RESULTS
The IPF was significantly different between each subtype of TP in both species. Immature platelet fractions <6.9% in dogs or 13.6% in cats, once PSE has been eliminated by review of blood smears, are indicative of CEN. Reference intervals for IPF were 0.5%-8% in healthy dogs and 1%-40.3% in healthy cats.
CONCLUSIONS AND CLINICAL IMPORTANCE
We determined that IPF can differentiate between CEN and PER in dogs and cats, guiding additional testing and avoiding more invasive procedures (bone marrow sampling). A blood smear always should be evaluated to rule out platelet clumping.
Topics: Animals; Dogs; Cats; Dog Diseases; Thrombocytopenia; Cat Diseases; Retrospective Studies; Female; Male; Diagnosis, Differential; Platelet Count; Blood Platelets; Reference Values
PubMed: 38619127
DOI: 10.1111/jvim.17074 -
International Journal of Biological... 2024Thrombocytopenia, a prevalent hematologic challenge, correlates directly with the mortality of numerous ailments. Current therapeutic avenues for thrombocytopenia are...
Thrombocytopenia, a prevalent hematologic challenge, correlates directly with the mortality of numerous ailments. Current therapeutic avenues for thrombocytopenia are not without limitations. Here, we identify genistin, an estrogen analogue, as a promising candidate for thrombocytopenia intervention, discovered through AI-driven compound library screening. While estrogen's involvement in diverse biological processes is recognized, its role in thrombopoiesis remains underexplored. Our findings elucidate genistin's ability to enhance megakaryocyte differentiation, thereby augmenting platelet formation and production. assessments further underscore genistin's remedial potential against radiation-induced thrombocytopenia. Mechanistically, genistin's efficacy is attributed to its direct interaction with estrogen receptor β (ERβ), with subsequent activation of both ERK1/2 and the Akt signaling pathways membrane ERβ. Collectively, our study positions genistin as a prospective therapeutic strategy for thrombocytopenia, shedding light on novel interplays between platelet production and ERβ.
Topics: Humans; Estrogen Receptor beta; Isoflavones; Thrombocytopenia; Small Molecule Libraries
PubMed: 38617546
DOI: 10.7150/ijbs.90483 -
International Journal of Molecular... Apr 2024The Philadelphia chromosome-negative myeloproliferative neoplasms (Ph-MPNs) are a heterogeneous group of clonal hematopoietic malignancies that include polycythemia vera...
Conventional Cytogenetic Analysis and Array CGH + SNP Identify Essential Thrombocythemia and Prefibrotic Primary Myelofibrosis Patients Who Are at Risk for Disease Progression.
The Philadelphia chromosome-negative myeloproliferative neoplasms (Ph-MPNs) are a heterogeneous group of clonal hematopoietic malignancies that include polycythemia vera (PV), essential thrombocythemia (ET), and the prefibrotic form of primary myelofibrosis (prePMF). In this study, we retrospectively reviewed the karyotypes from conventional cytogenetics (CC) and array Comparative Genomic Hybridization + Single Nucleotide Polymorphism (aCGH + SNP) in patients with ET or prePMF to determine whether the combined analysis of both methodologies can identify patients who may be at a higher risk of disease progression. We performed a comprehensive genomic review on 169 patients with a clinical diagnosis of ET (154 patients) or prePMF (15 patients). Genomic alterations detected by CC or array-CGH + SNP were detected in 36% of patients. In patients who progressed, 68% had an abnormal genomic finding by either technology. There was a shorter progression-free survival (PFS) among patients who were cytogenetically abnormal or who were cytogenetically normal but had an abnormal aCGH + SNP result. Leveraging the ability to detect submicroscopic copy number alterations and regions of copy neutral-loss of heterozygosity, we identified a higher number of patients harboring genomic abnormalities than previously reported. These results underscore the importance of genomic analysis in prognostication and provide valuable information for clinical management and treatment decisions.
Topics: Humans; Comparative Genomic Hybridization; Thrombocythemia, Essential; Polymorphism, Single Nucleotide; Primary Myelofibrosis; Retrospective Studies; Cytogenetic Analysis; Disease Progression
PubMed: 38612873
DOI: 10.3390/ijms25074061 -
Scientific Reports Apr 2024CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the...
CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.
Topics: Humans; CD36 Antigens; Blood Platelets; Blood Platelet Disorders; Databases, Factual; RNA
PubMed: 38609394
DOI: 10.1038/s41598-024-58491-z -
European Psychiatry : the Journal of... Apr 2024One of the challenges of psychiatry is the staging of patients, especially those with severe mental disorders. Therefore, we aim to develop an empirical staging model...
BACKGROUND
One of the challenges of psychiatry is the staging of patients, especially those with severe mental disorders. Therefore, we aim to develop an empirical staging model for schizophrenia.
METHODS
Data were obtained from 212 stable outpatients with schizophrenia: demographic, clinical, psychometric (PANSS, CAINS, CDSS, OSQ, CGI-S, PSP, MATRICS), inflammatory peripheral blood markers (C-reactive protein, interleukins-1RA and 6, and platelet/lymphocyte [PLR], neutrophil/lymphocyte [NLR], and monocyte/lymphocyte [MLR] ratios). We used machine learning techniques to develop the model (genetic algorithms, support vector machines) and applied a fitness function to measure the model's accuracy (% agreement between patient classification of our model and the CGI-S).
RESULTS
Our model includes 12 variables from 5 dimensions: 1) psychopathology: positive, negative, depressive, general psychopathology symptoms; 2) clinical features: number of hospitalizations; 3) cognition: processing speed, visual learning, social cognition; 4) biomarkers: PLR, NLR, MLR; and 5) functioning: PSP total score. Accuracy was 62% (SD = 5.3), and sensitivity values were appropriate for mild, moderate, and marked severity (from 0.62106 to 0.6728).
DISCUSSION
We present a multidimensional, accessible, and easy-to-apply model that goes beyond simply categorizing patients according to CGI-S score. It provides clinicians with a multifaceted patient profile that facilitates the design of personalized intervention plans.
Topics: Humans; Schizophrenia; Male; Female; Adult; Middle Aged; Internet; Severity of Illness Index; Machine Learning; Biomarkers; Psychometrics; Psychiatric Status Rating Scales
PubMed: 38599765
DOI: 10.1192/j.eurpsy.2024.17 -
Frontiers in Neurology 2024This study aims to elucidate the role of peripheral inflammation in Huntington's disease (HD) by examining the correlation of peripheral inflammatory markers with...
OBJECTIVES
This study aims to elucidate the role of peripheral inflammation in Huntington's disease (HD) by examining the correlation of peripheral inflammatory markers with clinical manifestations and disease prognosis.
METHODS
This investigation involved 92 HD patients and 92 matched healthy controls (HCs). We quantified various peripheral inflammatory markers and calculated their derived metrics including neutrophil-to-lymphocyte ratio (NLR), platelet-to-lymphocyte ratio (PLR), lymphocyte-to-monocyte ratio (LMR), and systemic immune-inflammation index (SII). Clinical assessments spanning cognitive, motor, and disease severity were administered. Comparative analysis of inflammatory markers and clinical correlations between HD and controls was performed. Kaplan-Meier survival analysis and Cox regression model were used to assess the effect of inflammatory markers on survival.
RESULTS
The study revealed that HD patients had significantly reduced lymphocyte counts, and LMR. Conversely, NLR, PLR, and SII were elevated compared to HCs. Lymphocyte levels inversely correlated with the age of onset and monocyte levels inversely correlated with the UHDRS-total functional capacity (TFC) scores. After adjusting for age, sex, and CAG repeat length, lymphocyte count, NLR, PLR, and SII were significantly correlated with the progression rate of TFC scores. Elevated levels of white blood cells and monocytes were associated with an increased risk of disability and mortality in the HD cohort.
CONCLUSION
Our findings indicate that HD patients display a distinct peripheral inflammatory profile with increased NLR, PLR, and SII levels compared to HCs. The peripheral inflammation appears to be linked with accelerated disease progression and decreased survival in HD.
PubMed: 38595854
DOI: 10.3389/fneur.2024.1374365 -
Journal of the American Academy of... Apr 2024Low platelet counts have clinically relevant effects on patient outcomes after hip fracture surgery; however, the relationship between abnormally high platelet counts...
INTRODUCTION
Low platelet counts have clinically relevant effects on patient outcomes after hip fracture surgery; however, the relationship between abnormally high platelet counts and postoperative outcomes in this population is unknown.
METHODS
The ACS-NSQIP database was queried for patients who underwent hip fracture surgery between 2015 and 2019. Outcomes were compared between patients with normal platelet counts (150,000 to 450,000/μL) and thrombocytosis (>450,000/μL).
RESULTS
Eighty-six thousand three hundred eleven hip fracture patients were identified, of which 1067 (1.2%) had preoperative thrombocytosis. Compared with patients with normal platelet counts, patients with preoperative thrombocytosis had increased rates of 30-day mortality (6.4% vs 4.5%, P = 0.004; OR 1.15 [95% CI 0.88 to 1.50], P = 0.322) as well as increased rates and odds of readmission (11.4% vs 7.8%, P < 0.001; OR 1.35 [95% CI 1.10 to 1.65], P = 0.004) and venous thromboembolic events (3.2% vs 1.7%, P < 0.001; OR 1.88 [95% CI 1.31 to 2.71], P < 0.001).
CONCLUSIONS
Hip fracture patients with preoperative thrombocytosis had increased rates of early mortality as well as increased odds of venous thromboembolic events and readmission. A patient with thrombocytosis may benefit from close postoperative surveillance and careful follow-up. Future prospective studies are needed to verify causation and investigate how to mitigate adverse outcomes in hip fracture patients with preoperative thrombocytosis.
Topics: Humans; Treatment Outcome; Retrospective Studies; Thrombocytosis; Hip Fractures; Thromboembolism; Venous Thrombosis
PubMed: 38595218
DOI: 10.5435/JAAOSGlobal-D-23-00159 -
Spanish Journal of Psychiatry and... Sep 2023Neutrophil/lymphocyte (NLR), monocyte/lymphocyte (MLR), and platelet/lymphocyte (PLR) ratios, and systemic inflammatory index (SII) represent peripheral markers of...
INTRODUCTION
Neutrophil/lymphocyte (NLR), monocyte/lymphocyte (MLR), and platelet/lymphocyte (PLR) ratios, and systemic inflammatory index (SII) represent peripheral markers of inflammation associated with different severe mental disorders.
MATERIAL AND METHODS
In this study, these parameters were analyzed in a sample of 622 participants [197 patients with major depressive disorder (MDD), 154 with bipolar disorder (BD), 176 with schizophrenia (SCH), and 95 healthy controls (HC)]. Sociodemographic and clinical data of patients were recorded.
RESULTS
Differences in age and sex were detected among groups (p<0.001), with SCH patients being younger and MDD patients being older. After stratifying by sex, these ratios were compared using the nonparametric ANCOVA (Quade's test) using age as a covariate. In males, no significant statistical differences were found between groups. However, differences were observed in MLR in the subgroup of females [MDD: 0.23 (SD=0.09); BD: 0.23 (SD=0.11); SCH: 0.24 (SD=0.11); HC: 0.29 (SD=0.13); F=5.376, p=0.001]. Post hoc testing revealed that there are MLR differences between HC versus MDD and between HC versus BD, with higher values in HC versus the other two groups. On the other hand, no differences were found in either males or females for any of the studied ratios, among the three diagnostic groups.
CONCLUSIONS
MLR is reduced in MDD and BD patients versus HC, but exclusively in the female group. However, based on the analyzed indices, it is not possible to differentiate among the three diagnostic groups of patients. As a limitation of this study, note that the effects of psychopharmacological treatments and smoking have not been controlled for.
PubMed: 38591835
DOI: 10.1016/j.sjpmh.2023.03.002 -
Archives of Razi Institute Oct 2023The Iranian (IEC) venom is an exclusive natural source of bio-substances for a wide range of purposes in the blood coagulation cascade. The present study for the first...
The Iranian (IEC) venom is an exclusive natural source of bio-substances for a wide range of purposes in the blood coagulation cascade. The present study for the first time was aimed to assess novel pro-coagulant, anti-coagulant and anti-platelet proteins, named EC, EC and EC from Iranian (IEC) venom. These peptides were purified by multi-step chromatography methods. Hematological properties were measured using activated clotting tests, platelet aggregation studies, and hemorrhage assessment. Subsequently, these proteins were identified through both their intact molecular mass and peptide mass fingerprint (PMF) using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Multiple sequence alignments were performed by ClustalW, Bioedit software. Molegro Data Modeller (MDM) 3.0 software was used to predict the putative tertiary structure of proteins.EC, a single-band protein with a molecular mass of 66 and 55 kDa, was observed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis as a reduced and non-reduced state, respectively. Based on the Mascot results, we considered that EC is a metalloproteinase of group ΙΙ which exhibited potent pro-coagulant activity. It is predicted that the EC with hemorrhagic activity, potentially is a metalloproteinase/disintegrin region that constitutes the disintegrin-like domains. Our findings demonstrate that the disintegrin domain of EC lacks platelet aggregation inhibitory activity. On the contrary, this factor shows the property of a platelet aggregation inducer. Also, the EC was observed as a single-band protein with a molecular mass of 7.5 kDa. EC showed both anti-coagulant and anti-platelet properties. Additionally, the structure of the EC fraction is expected to be similar to that of phospholipase A, while EC structure is potentially very similar to that of Echistatin with 5 kDa molecular mass. We introduce the predicted structure of P-II snake venom metalloproteinase/ disintegrin domains, phospholipase A and Echistatin-like fractions. Further research is therefore needed to determine the complete structure of these novel fractions and elucidate their mechanism of action and future therapeutic applications of cardiovascular and homeostasis disorders.
Topics: Animals; Amino Acid Sequence; Iran; Spectrometry, Mass, Matrix-Assisted Laser Desorption-Ionization; Disintegrins; Echis; Snake Venoms; Metalloproteases; Coagulants; Phospholipases
PubMed: 38590689
DOI: 10.22092/ARI.2023.78.5.1503